ID: 957264879

View in Genome Browser
Species Human (GRCh38)
Location 3:77950142-77950164
Sequence GCCCTTCATGTCTGGTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957264879_957264883 -1 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264883 3:77950164-77950186 CCTGGCCATACAGCTTGCTCAGG No data
957264879_957264889 18 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264889 3:77950183-77950205 CAGGGGGTTGGCCACTATACTGG No data
957264879_957264885 1 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264885 3:77950166-77950188 TGGCCATACAGCTTGCTCAGGGG No data
957264879_957264886 2 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264886 3:77950167-77950189 GGCCATACAGCTTGCTCAGGGGG No data
957264879_957264884 0 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264884 3:77950165-77950187 CTGGCCATACAGCTTGCTCAGGG No data
957264879_957264888 6 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264888 3:77950171-77950193 ATACAGCTTGCTCAGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957264879 Original CRISPR GCCCTTCATGTCTGGTGAGA AGG (reversed) Intergenic
No off target data available for this crispr