ID: 957264881

View in Genome Browser
Species Human (GRCh38)
Location 3:77950150-77950172
Sequence ATGGCCAGGCCCTTCATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957264881_957264885 -7 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264885 3:77950166-77950188 TGGCCATACAGCTTGCTCAGGGG No data
957264881_957264884 -8 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264884 3:77950165-77950187 CTGGCCATACAGCTTGCTCAGGG No data
957264881_957264889 10 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264889 3:77950183-77950205 CAGGGGGTTGGCCACTATACTGG No data
957264881_957264888 -2 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264888 3:77950171-77950193 ATACAGCTTGCTCAGGGGGTTGG No data
957264881_957264886 -6 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264886 3:77950167-77950189 GGCCATACAGCTTGCTCAGGGGG No data
957264881_957264883 -9 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264883 3:77950164-77950186 CCTGGCCATACAGCTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957264881 Original CRISPR ATGGCCAGGCCCTTCATGTC TGG (reversed) Intergenic
No off target data available for this crispr