ID: 957264885

View in Genome Browser
Species Human (GRCh38)
Location 3:77950166-77950188
Sequence TGGCCATACAGCTTGCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957264881_957264885 -7 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264885 3:77950166-77950188 TGGCCATACAGCTTGCTCAGGGG No data
957264879_957264885 1 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264885 3:77950166-77950188 TGGCCATACAGCTTGCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957264885 Original CRISPR TGGCCATACAGCTTGCTCAG GGG Intergenic
No off target data available for this crispr