ID: 957264889

View in Genome Browser
Species Human (GRCh38)
Location 3:77950183-77950205
Sequence CAGGGGGTTGGCCACTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957264879_957264889 18 Left 957264879 3:77950142-77950164 CCTTCTCACCAGACATGAAGGGC No data
Right 957264889 3:77950183-77950205 CAGGGGGTTGGCCACTATACTGG No data
957264882_957264889 -4 Left 957264882 3:77950164-77950186 CCTGGCCATACAGCTTGCTCAGG No data
Right 957264889 3:77950183-77950205 CAGGGGGTTGGCCACTATACTGG No data
957264881_957264889 10 Left 957264881 3:77950150-77950172 CCAGACATGAAGGGCCTGGCCAT No data
Right 957264889 3:77950183-77950205 CAGGGGGTTGGCCACTATACTGG No data
957264887_957264889 -9 Left 957264887 3:77950169-77950191 CCATACAGCTTGCTCAGGGGGTT No data
Right 957264889 3:77950183-77950205 CAGGGGGTTGGCCACTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957264889 Original CRISPR CAGGGGGTTGGCCACTATAC TGG Intergenic
No off target data available for this crispr