ID: 957270060

View in Genome Browser
Species Human (GRCh38)
Location 3:78018535-78018557
Sequence GGATGTTCCAGCCTTTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957270060_957270064 -9 Left 957270060 3:78018535-78018557 CCAATGCAAAGGCTGGAACATCC No data
Right 957270064 3:78018549-78018571 GGAACATCCCTGGGGTATTTAGG No data
957270060_957270067 25 Left 957270060 3:78018535-78018557 CCAATGCAAAGGCTGGAACATCC No data
Right 957270067 3:78018583-78018605 AAGAAATTGTGTACTGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957270060 Original CRISPR GGATGTTCCAGCCTTTGCAT TGG (reversed) Intergenic
No off target data available for this crispr