ID: 957278711

View in Genome Browser
Species Human (GRCh38)
Location 3:78122581-78122603
Sequence GAAAGTGCAGGAATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957278711_957278716 26 Left 957278711 3:78122581-78122603 CCCAGCTGCATTCCTGCACTTTC No data
Right 957278716 3:78122630-78122652 TCTCGCTCTGTCGCCCAGGCTGG 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
957278711_957278714 1 Left 957278711 3:78122581-78122603 CCCAGCTGCATTCCTGCACTTTC No data
Right 957278714 3:78122605-78122627 TTTTTTGTGTTTTTTTTTGATGG No data
957278711_957278715 22 Left 957278711 3:78122581-78122603 CCCAGCTGCATTCCTGCACTTTC No data
Right 957278715 3:78122626-78122648 GGAGTCTCGCTCTGTCGCCCAGG 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957278711 Original CRISPR GAAAGTGCAGGAATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr