ID: 957280836

View in Genome Browser
Species Human (GRCh38)
Location 3:78149447-78149469
Sequence TTTGCTTACATATAAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957280836_957280840 13 Left 957280836 3:78149447-78149469 CCCTGGGTTTATATGTAAGCAAA No data
Right 957280840 3:78149483-78149505 AATGTAAACAGTCATTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957280836 Original CRISPR TTTGCTTACATATAAACCCA GGG (reversed) Intergenic
No off target data available for this crispr