ID: 957281185

View in Genome Browser
Species Human (GRCh38)
Location 3:78153806-78153828
Sequence TGGGATACACCCCCTGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957281181_957281185 5 Left 957281181 3:78153778-78153800 CCAGTGTGACAGGGGGAGAGGCT No data
Right 957281185 3:78153806-78153828 TGGGATACACCCCCTGACCAAGG No data
957281180_957281185 6 Left 957281180 3:78153777-78153799 CCCAGTGTGACAGGGGGAGAGGC No data
Right 957281185 3:78153806-78153828 TGGGATACACCCCCTGACCAAGG No data
957281178_957281185 7 Left 957281178 3:78153776-78153798 CCCCAGTGTGACAGGGGGAGAGG No data
Right 957281185 3:78153806-78153828 TGGGATACACCCCCTGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957281185 Original CRISPR TGGGATACACCCCCTGACCA AGG Intergenic
No off target data available for this crispr