ID: 957288573

View in Genome Browser
Species Human (GRCh38)
Location 3:78248344-78248366
Sequence ACATATATTCTAAAATTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957288571_957288573 27 Left 957288571 3:78248294-78248316 CCAAAATGATGTTCAATCTTCTT No data
Right 957288573 3:78248344-78248366 ACATATATTCTAAAATTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957288573 Original CRISPR ACATATATTCTAAAATTGTA TGG Intergenic
No off target data available for this crispr