ID: 957293432

View in Genome Browser
Species Human (GRCh38)
Location 3:78306669-78306691
Sequence AGGCTTCTGCCAGGACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957293432_957293439 25 Left 957293432 3:78306669-78306691 CCTGCATGTCCTGGCAGAAGCCT No data
Right 957293439 3:78306717-78306739 AAACCTCTATGACAGCAGTGTGG No data
957293432_957293435 -7 Left 957293432 3:78306669-78306691 CCTGCATGTCCTGGCAGAAGCCT No data
Right 957293435 3:78306685-78306707 GAAGCCTGCTCTATGTGTGGAGG No data
957293432_957293437 1 Left 957293432 3:78306669-78306691 CCTGCATGTCCTGGCAGAAGCCT No data
Right 957293437 3:78306693-78306715 CTCTATGTGTGGAGGCCTGATGG No data
957293432_957293434 -10 Left 957293432 3:78306669-78306691 CCTGCATGTCCTGGCAGAAGCCT No data
Right 957293434 3:78306682-78306704 GCAGAAGCCTGCTCTATGTGTGG No data
957293432_957293442 30 Left 957293432 3:78306669-78306691 CCTGCATGTCCTGGCAGAAGCCT No data
Right 957293442 3:78306722-78306744 TCTATGACAGCAGTGTGGAAGGG No data
957293432_957293441 29 Left 957293432 3:78306669-78306691 CCTGCATGTCCTGGCAGAAGCCT No data
Right 957293441 3:78306721-78306743 CTCTATGACAGCAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957293432 Original CRISPR AGGCTTCTGCCAGGACATGC AGG (reversed) Intergenic
No off target data available for this crispr