ID: 957294592

View in Genome Browser
Species Human (GRCh38)
Location 3:78321105-78321127
Sequence CAGTAAAAGTTGTTTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957294590_957294592 13 Left 957294590 3:78321069-78321091 CCTTAGGAAAATTCTTGTCTCTT No data
Right 957294592 3:78321105-78321127 CAGTAAAAGTTGTTTGGTTCTGG No data
957294589_957294592 24 Left 957294589 3:78321058-78321080 CCACAGTTTGACCTTAGGAAAAT No data
Right 957294592 3:78321105-78321127 CAGTAAAAGTTGTTTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957294592 Original CRISPR CAGTAAAAGTTGTTTGGTTC TGG Intergenic
No off target data available for this crispr