ID: 957296912

View in Genome Browser
Species Human (GRCh38)
Location 3:78344277-78344299
Sequence CGGCAAACCCCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957296905_957296912 29 Left 957296905 3:78344225-78344247 CCTGCTGGATCTAGAGGGATGGA No data
Right 957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG No data
957296903_957296912 30 Left 957296903 3:78344224-78344246 CCCTGCTGGATCTAGAGGGATGG No data
Right 957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957296912 Original CRISPR CGGCAAACCCCAGTGGTGGA TGG Intergenic
No off target data available for this crispr