ID: 957298456

View in Genome Browser
Species Human (GRCh38)
Location 3:78361272-78361294
Sequence TATGCAGGCACCACCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957298456_957298458 3 Left 957298456 3:78361272-78361294 CCACTTTTGGTGGTGCCTGCATA No data
Right 957298458 3:78361298-78361320 TGCAGAACCATCTATAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957298456 Original CRISPR TATGCAGGCACCACCAAAAG TGG (reversed) Intergenic
No off target data available for this crispr