ID: 957298498

View in Genome Browser
Species Human (GRCh38)
Location 3:78361635-78361657
Sequence AACAGCTCTTGGCCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957298498_957298502 11 Left 957298498 3:78361635-78361657 CCAGCAGCAGGCCAAGAGCTGTT No data
Right 957298502 3:78361669-78361691 AAGTAGTTATCAGTAGAAGATGG No data
957298498_957298503 16 Left 957298498 3:78361635-78361657 CCAGCAGCAGGCCAAGAGCTGTT No data
Right 957298503 3:78361674-78361696 GTTATCAGTAGAAGATGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957298498 Original CRISPR AACAGCTCTTGGCCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr