ID: 957304543

View in Genome Browser
Species Human (GRCh38)
Location 3:78440892-78440914
Sequence CCAAAGCTGTGGTAGGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957304538_957304543 26 Left 957304538 3:78440843-78440865 CCTTTCTTCGATATAAAAATTTC No data
Right 957304543 3:78440892-78440914 CCAAAGCTGTGGTAGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957304543 Original CRISPR CCAAAGCTGTGGTAGGTGTA TGG Intergenic
No off target data available for this crispr