ID: 957305441

View in Genome Browser
Species Human (GRCh38)
Location 3:78452274-78452296
Sequence AAGTTGCCACAGCATTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957305435_957305441 24 Left 957305435 3:78452227-78452249 CCTGGTATCCACATCACTGGCAT No data
Right 957305441 3:78452274-78452296 AAGTTGCCACAGCATTCTCAGGG No data
957305437_957305441 16 Left 957305437 3:78452235-78452257 CCACATCACTGGCATTAGGACAG No data
Right 957305441 3:78452274-78452296 AAGTTGCCACAGCATTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957305441 Original CRISPR AAGTTGCCACAGCATTCTCA GGG Intergenic
No off target data available for this crispr