ID: 957309127

View in Genome Browser
Species Human (GRCh38)
Location 3:78496867-78496889
Sequence CACCCACTCCTTTCCGTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957309127_957309132 16 Left 957309127 3:78496867-78496889 CCATCGACGGAAAGGAGTGGGTG No data
Right 957309132 3:78496906-78496928 CCCTGATTACTTATAATAGCAGG No data
957309127_957309134 21 Left 957309127 3:78496867-78496889 CCATCGACGGAAAGGAGTGGGTG No data
Right 957309134 3:78496911-78496933 ATTACTTATAATAGCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957309127 Original CRISPR CACCCACTCCTTTCCGTCGA TGG (reversed) Intergenic
No off target data available for this crispr