ID: 957311431

View in Genome Browser
Species Human (GRCh38)
Location 3:78524350-78524372
Sequence ATTTATTGGCAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957311424_957311431 6 Left 957311424 3:78524321-78524343 CCAAAAAATGTGCTCCCTAACCC No data
Right 957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG No data
957311425_957311431 -8 Left 957311425 3:78524335-78524357 CCCTAACCCACACAGATTTATTG No data
Right 957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG No data
957311426_957311431 -9 Left 957311426 3:78524336-78524358 CCTAACCCACACAGATTTATTGG No data
Right 957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957311431 Original CRISPR ATTTATTGGCAGAAGATGGA AGG Intergenic
No off target data available for this crispr