ID: 957318621

View in Genome Browser
Species Human (GRCh38)
Location 3:78600729-78600751
Sequence GTCTCACGTGTCCATGTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957318621 Original CRISPR GTCTCACGTGTCCATGTGAA CGG (reversed) Intronic
903791824 1:25898463-25898485 ATATCACGTGCCCATGTGAGGGG - Intronic
910072016 1:83228030-83228052 GTTGCAAGTGTCCAAGTGAAAGG + Intergenic
913127815 1:115809533-115809555 ATCTCACTTGTGCATGTAAATGG - Intergenic
915075186 1:153302429-153302451 GTTCCGTGTGTCCATGTGAAAGG + Exonic
915610435 1:156987702-156987724 GTCTCACCTGTCCAGGTAAGAGG - Intronic
916270919 1:162940579-162940601 GTTTCACGTTTGCTTGTGAATGG - Intergenic
920922159 1:210307065-210307087 GTCTCACATGTCCTTATGAATGG + Intergenic
924749173 1:246869337-246869359 ACCTCAAGTGTTCATGTGAAAGG + Intronic
1063513455 10:6670490-6670512 GTGTCACTTGTCAATGTCAAGGG + Intergenic
1069266923 10:66470755-66470777 GTCAGCCGTGTCGATGTGAAAGG + Intronic
1082665678 11:55972517-55972539 GGTTCAGGTGTCCATTTGAAGGG - Intergenic
1083284756 11:61651249-61651271 GTCTCAGGTTTCCCTGTGAGAGG - Intergenic
1085508810 11:77074936-77074958 GTCTCACGTGTGGATGCGGAGGG - Intronic
1085708692 11:78809930-78809952 GTCTCACTTTTCACTGTGAAAGG + Intronic
1092623628 12:10301849-10301871 GCCTCATGTGTTCAAGTGAAAGG - Intergenic
1097030533 12:56086442-56086464 GTCTCAGGTGTCCTTTTGGATGG + Intronic
1099113305 12:78590241-78590263 GTCTCACAGCTCCATGAGAATGG + Intergenic
1101236193 12:102792674-102792696 GGCTCATGTGACCTTGTGAAGGG - Intergenic
1101672902 12:106893227-106893249 GTCTCACTCGTCCATATGGAGGG + Intergenic
1103995484 12:124827252-124827274 CTCTAAGGGGTCCATGTGAAAGG + Intronic
1117221642 14:53612169-53612191 GTCAGATGTGTCCATGTGACAGG - Intergenic
1117954827 14:61114519-61114541 CTCTAAGGAGTCCATGTGAAAGG + Intergenic
1118533298 14:66731117-66731139 GACTCACATGTCCATGTGGCTGG - Intronic
1120211775 14:81640849-81640871 CTCTAAGGGGTCCATGTGAAAGG + Intergenic
1121160312 14:91732761-91732783 GTTTTACATGGCCATGTGAAGGG - Intronic
1124594555 15:31082112-31082134 GTGCCACCTGTCCTTGTGAAAGG + Intronic
1131457746 15:92596633-92596655 GCCCCACTTGTCCATGTGAGAGG - Intergenic
1131837922 15:96409050-96409072 GTCCCACGTGTGCACGTGAAGGG - Intergenic
1139199621 16:64960628-64960650 CTCTCACATGTCCATGTGCAGGG - Intronic
1140844065 16:78870076-78870098 CTGTCACCTGTCCATGTGTAAGG + Intronic
1143095160 17:4474984-4475006 GTCTCACGTGCACTTGTGAGAGG + Intronic
1153271278 18:3324266-3324288 GTCATAGGTGTCCATTTGAAAGG + Intergenic
1153943315 18:9995609-9995631 GTCCCACTTGACCATGTAAAGGG + Intergenic
1155822825 18:30399523-30399545 GTCACATATGTCAATGTGAATGG + Intergenic
1156860727 18:41833376-41833398 TTCTTACGTATGCATGTGAATGG - Intergenic
1159929848 18:74299013-74299035 GTCACGTGTGTCCGTGTGAAGGG - Intergenic
1161477121 19:4492562-4492584 GTCTGGTGTGTCCATGTGTATGG + Intronic
1165368151 19:35382777-35382799 CTCTAAGGGGTCCATGTGAAAGG - Intergenic
1167318524 19:48780920-48780942 AAGTCACGTGTCCATGTGACAGG + Intergenic
929725656 2:44424377-44424399 CTCTAAGGGGTCCATGTGAAAGG + Intronic
931798330 2:65733508-65733530 GTCCCAAATGACCATGTGAAAGG + Intergenic
933630126 2:84646373-84646395 GTCTCTAGTGTTCAAGTGAAAGG + Intronic
938111928 2:128573670-128573692 GTGTCCCGTGGCCATATGAATGG - Intergenic
938660879 2:133485936-133485958 GTATCACATGCCCATCTGAAAGG + Intronic
938846303 2:135212966-135212988 GTCTCACTTTTACATTTGAATGG - Intronic
941006890 2:160257361-160257383 GCTTCAGGTGTCCATGTGGAGGG + Intronic
943448416 2:188018742-188018764 GACTCACGTTTCCATATGACTGG - Intergenic
1170584638 20:17725226-17725248 CTGCCACGTGTCCCTGTGAAGGG + Intronic
1175017116 20:55803618-55803640 CTCTGACTTGTCCGTGTGAAAGG + Intergenic
1175837852 20:62007783-62007805 GTCACACATGTACCTGTGAAAGG - Intronic
1179528093 21:41996974-41996996 GACTCACAGGTCCATGTGACTGG - Intronic
1180837593 22:18938121-18938143 GTCTCATGTGTCCCTGTGAAGGG + Intergenic
1182492435 22:30682391-30682413 GTCTCACGGGTGAATGGGAAGGG + Intergenic
1184542519 22:45137232-45137254 GTCTAACATGTCCATGCGATTGG + Intergenic
1203287686 22_KI270734v1_random:163420-163442 GTCTCATGTGTCCCTGTGAAGGG + Intergenic
955512890 3:59698871-59698893 GACTCACGTCTCCATGTAACAGG - Intergenic
957318621 3:78600729-78600751 GTCTCACGTGTCCATGTGAACGG - Intronic
959398649 3:105871958-105871980 GTCTCACATGTCCTTATGACCGG - Intergenic
961978623 3:131053587-131053609 CTCTCCAGTGTCCATGAGAATGG + Intronic
962524270 3:136223286-136223308 GTCACATGTGTCCGTGTGAAGGG + Intergenic
962633193 3:137300708-137300730 ATCTCAAGTGTGCATTTGAAAGG - Intergenic
969638734 4:8384283-8384305 GTCTGATGTGTTCATGTGCAGGG + Intronic
970356696 4:15260891-15260913 GCCTCAAGTGTCCAAGTGAAAGG + Intergenic
970732305 4:19120604-19120626 GTCTCAGCTGTCCATGTCGAAGG - Intergenic
973168195 4:47105097-47105119 GACTCAATTGTCCATGTGGAAGG - Intronic
983096844 4:163572715-163572737 GTTTCATGTTTCCATGTGGAGGG + Intronic
985874300 5:2583700-2583722 ATCTCACTTGCCAATGTGAATGG + Intergenic
986712219 5:10496261-10496283 GCCTCACGTGGCAATGTGGATGG - Intergenic
990554471 5:56917510-56917532 GTCTCATGTCTTCATGTGGAGGG + Intergenic
994412657 5:99428106-99428128 CTCACACATGTCCTTGTGAAAGG - Intergenic
1000234137 5:159342016-159342038 GTCCCACGTGTCTATCTGATGGG + Intergenic
1001628987 5:173160592-173160614 TTCCCATGTGTTCATGTGAAAGG + Intronic
1005576495 6:27194680-27194702 AAGTCACGTGTCCATGTGACAGG + Intergenic
1007344527 6:41218061-41218083 GTTTCAGGTGTTCATGTGCAGGG - Intergenic
1011564659 6:88662423-88662445 CTCTGAGGGGTCCATGTGAAAGG - Intronic
1011788338 6:90870512-90870534 TTCTTAAGTGTCCATGTGGAAGG + Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1019290187 7:246492-246514 GGCTCACCTGTCCAGGTGGAAGG - Exonic
1023623900 7:42097558-42097580 GGCTCTCGTGTCCATGGAAATGG + Intronic
1027289730 7:76693009-76693031 GTTGCAAGTGTCCAAGTGAAAGG + Intergenic
1034250838 7:149689386-149689408 GTCTCACATGTACATGTGACTGG + Intergenic
1034667258 7:152829488-152829510 GTCTGACGTGTAGATGAGAAGGG + Intronic
1035876307 8:3193531-3193553 GTCTGAAATGTCCAGGTGAAGGG - Intronic
1039725732 8:40214366-40214388 GTCACAGGTGTCTATGTGAGTGG - Intergenic
1040974809 8:53178195-53178217 GTTTCAGGTTTCCCTGTGAAGGG + Intergenic
1043240557 8:77928828-77928850 GTCTCACATTTCCATGTGGTTGG + Intergenic
1044297479 8:90545593-90545615 TTCTGAAGTGTCCATGTGAATGG + Intergenic
1049565759 8:143337979-143338001 CTCTAAGGGGTCCATGTGAAAGG - Intronic
1050203630 9:3175523-3175545 CTCCCTCATGTCCATGTGAAGGG + Intergenic
1056366978 9:85915304-85915326 GTCTCAAATGTCTTTGTGAAAGG + Intergenic
1061028024 9:128063171-128063193 GGGTCACGTGTGCATGTGATGGG - Exonic
1061579572 9:131528887-131528909 GTCCCATGTGTCCTTGTGAAAGG + Intronic
1185578646 X:1193417-1193439 GACACATGTGTCCATGTGGAAGG - Intronic
1192459962 X:71308562-71308584 GTGTCACCTGTACATTTGAATGG + Intergenic
1193145235 X:78069197-78069219 CTCTAAGGGGTCCATGTGAAAGG + Intronic
1195619004 X:106934678-106934700 GTTTCACGTGTCCCTTTGTAGGG + Intronic
1201891086 Y:18944925-18944947 GTTACACACGTCCATGTGAAGGG + Intergenic
1202037773 Y:20651763-20651785 CTCTAAGGGGTCCATGTGAAAGG - Intergenic
1202152740 Y:21857864-21857886 ATCTAAGGGGTCCATGTGAAAGG + Intergenic