ID: 957322505

View in Genome Browser
Species Human (GRCh38)
Location 3:78650469-78650491
Sequence CTTGCTAAGTCCCCTTGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957322505 Original CRISPR CTTGCTAAGTCCCCTTGTGA CGG Intronic
904993592 1:34613739-34613761 CTTGCTAGGTCCCCTCCTGAGGG - Intergenic
905871826 1:41408734-41408756 CTGGCTGAGTCCCCCTGGGAAGG - Intergenic
906672505 1:47666706-47666728 CTTGCTAAGTTCCATTGGTATGG - Intergenic
907826248 1:58019753-58019775 CTTGCTTAGTCCCACTGAGAGGG - Intronic
910089560 1:83446079-83446101 TCTGCTAAGTGCCCTTGAGAGGG + Intergenic
913973274 1:143433024-143433046 CTTGCTATGTCCTCATGTGGTGG - Intergenic
914067660 1:144258631-144258653 CTTGCTATGTCCTCATGTGGTGG - Intergenic
914111495 1:144707723-144707745 CTTGCTATGTCCTCATGTGGTGG + Intergenic
915315453 1:155026245-155026267 CTAGCTAAGCCCCCTGGGGAGGG + Intronic
916167569 1:161977489-161977511 CTTGCTGAGGCCACTGGTGAGGG - Intergenic
918585230 1:186179518-186179540 CTTGCTAATTCCCCTTGAGTAGG - Intronic
919784358 1:201249927-201249949 CATGCTCAGTCCCCTTGCCATGG - Intergenic
922315391 1:224437099-224437121 CTTGCTAAGACCCCTTCTTCAGG + Intronic
1063569423 10:7201164-7201186 CTTGCTAAGATCTCTTGTAAGGG - Intronic
1067701243 10:48574519-48574541 CTTGCTAAGTCAACTTGAGCTGG + Intronic
1068922974 10:62504426-62504448 CTTGCTAAGTCCTTGTGGGATGG + Intronic
1075322143 10:121499910-121499932 CCTGCTACTTCCCCTTGGGAGGG + Intronic
1076095341 10:127730528-127730550 CTAGCTAAGACCATTTGTGAAGG - Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079064647 11:17278801-17278823 CTTTCTAAGGACCCTTTTGAAGG + Intronic
1081479723 11:43474585-43474607 CTTGATAATTCCCCTTGGTATGG - Intronic
1087085428 11:94213447-94213469 CTTGCTAACTTTTCTTGTGAAGG + Intergenic
1089576853 11:119450762-119450784 CTTGCTGAGTCACGTGGTGATGG + Intergenic
1091308639 11:134557467-134557489 CTTGCTCAGTGCTCGTGTGATGG + Intergenic
1101822782 12:108196733-108196755 CTTGCTGGGTCCCTTGGTGATGG + Intronic
1108466679 13:50723607-50723629 CTTGCTGTGTCCTCATGTGAGGG + Intronic
1110819802 13:79901299-79901321 CTTGTTAACTCCGCTTGTTAAGG + Intergenic
1112470589 13:99685024-99685046 ATTGCTAAGTCCCCCTTAGAGGG - Intronic
1113133936 13:107068187-107068209 CTTGCTGAGTGACCTTGGGATGG + Intergenic
1115469372 14:33752900-33752922 CTTGCTAAGTGCCCATATTATGG - Intronic
1121096785 14:91222925-91222947 CTTGCTGAGTCCGCATGTGGTGG + Intronic
1121337138 14:93084302-93084324 GTTGCTAAATCTCCTTGTGGGGG - Intronic
1127120366 15:55766551-55766573 CTTGATAAGTCCCCTAGGAAAGG - Intergenic
1127700295 15:61493003-61493025 CCTGCTTAGTCCCCTTGCCATGG + Intergenic
1135345956 16:21688666-21688688 CTCGCTGTGTCCCCTTGTGGTGG + Intronic
1137779316 16:51084265-51084287 ATTGCTCAGTCACCTTGTGGTGG - Intergenic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1147465698 17:40609060-40609082 CTTGCTATGTCCTCATGTGGTGG + Intergenic
1148622399 17:49044245-49044267 CTTGCTTGGTCCCCATGGGATGG + Intronic
1148957126 17:51363091-51363113 CTTTCTAAGGCCCCTTTTGCAGG + Intergenic
1149886826 17:60348437-60348459 CTTGATAAGTCCCCTTTTCCTGG - Intronic
1157155584 18:45262394-45262416 CTGGCTAACTCCCCTTTTGCTGG - Intronic
1158093208 18:53739706-53739728 CTTCCTAAGACCCCTTGTCTTGG - Intergenic
1159260845 18:66010165-66010187 CTTGCTATGTCCTCATGTGGTGG + Intergenic
1160526997 18:79544070-79544092 CTTGCGAAGGCCGCTGGTGATGG + Intergenic
1160997817 19:1892235-1892257 CATGCTCAGTCCCCTCTTGACGG + Intergenic
925675573 2:6357936-6357958 CTTGCTATGTCCTCATGTGGTGG - Intergenic
933531433 2:83517277-83517299 CTCGCTATGTCCCCTTGCTAGGG + Intergenic
934177969 2:89593981-89594003 CTTGCTATGTCCTCATGTGGTGG - Intergenic
934288267 2:91668282-91668304 CTTGCTATGTCCTCATGTGGTGG - Intergenic
947907598 2:233776749-233776771 GTTGCAAAGTCACATTGTGAAGG - Intronic
1172597923 20:36163048-36163070 CTGGGGAAGTCCCCTTGGGAAGG + Intronic
1175662892 20:60832271-60832293 CTTGCTAAGGCCCCTTCTCCTGG + Intergenic
1177785927 21:25671380-25671402 CTTGGTAAGTACTCTTGTAAGGG + Intronic
1179271121 21:39851714-39851736 CTTGCTACGTCTCCTTCAGATGG + Intergenic
1182990874 22:34766326-34766348 CTTGCTGTGTCCTCTTGTGGTGG - Intergenic
951054544 3:18132593-18132615 TTTGCAAAGTCACGTTGTGAAGG + Intronic
952350088 3:32526714-32526736 CTTTCTAATTCCACTTTTGAAGG + Exonic
954435655 3:50494497-50494519 CTTTCTGGGTCCCCTTGGGAAGG - Intronic
957322505 3:78650469-78650491 CTTGCTAAGTCCCCTTGTGACGG + Intronic
959001136 3:100965540-100965562 CTTACTAAAACCCCTTCTGATGG - Intronic
962241298 3:133753414-133753436 GTGGCTAAGTGCCCTTGCGAGGG + Intronic
964510119 3:157440778-157440800 ATGGCTAAGTCGCCTTGAGATGG + Intronic
969831276 4:9799407-9799429 CTTGCTATGTCCTCATGTGGTGG + Intronic
970350320 4:15195559-15195581 CTTGCTACATCACCTTGTCAGGG + Intergenic
973968334 4:56186184-56186206 CTAGCTAAATCCTTTTGTGATGG + Intronic
982610862 4:157573408-157573430 CTTGCTTAGTGCTCTTGTCAGGG - Intergenic
985768995 5:1797375-1797397 CTTGCAGAGGCCCTTTGTGAGGG + Intergenic
986442528 5:7794504-7794526 CTTGCTCAGGCCCTTTGTGTGGG - Intronic
993043985 5:82846955-82846977 CTTCCTAAGCTTCCTTGTGATGG + Intergenic
994058399 5:95446187-95446209 TTTGATAAGTTCCCTTGTGGTGG - Intronic
994060962 5:95476040-95476062 GTTGCTGGGTCCCCTTGTGCAGG + Intronic
995968930 5:117943305-117943327 CTTGCTAAGGCCTCTCTTGAAGG + Intergenic
996422300 5:123276108-123276130 CTTAATGAGTCCCCTTCTGATGG - Intergenic
997993562 5:138567015-138567037 CTTGCTACGGCACATTGTGAAGG - Exonic
1005921572 6:30406454-30406476 CTTGATCAGTCCCCATGTTATGG - Intergenic
1007964198 6:45988523-45988545 ATTCCTAAAGCCCCTTGTGATGG - Intronic
1012640082 6:101599302-101599324 CTTGATCAGTCCCCTATTGATGG + Intronic
1016917235 6:149255238-149255260 CTTGCTATGTCCTCTCCTGATGG - Intronic
1018642586 6:165917879-165917901 CTTGCTGAGTCCCCGAGTGCAGG + Intronic
1027306418 7:76902517-76902539 TCTGCTAAGTGCCCTTGAGAGGG + Intergenic
1028937946 7:96486686-96486708 GTTACCAAGTCCCCTTGTGTTGG - Intronic
1033796814 7:144855073-144855095 CATCCCAAGTCCCCTTGTTAAGG + Intergenic
1034460360 7:151194629-151194651 CTTGCTAATGTCCCTTGTGGTGG - Intronic
1034959325 7:155355269-155355291 CTTGCTGGGTACCCTTGGGAAGG - Intergenic
1037623081 8:20584133-20584155 CTTGCTAAGTCACTTTGGCAAGG - Intergenic
1041322337 8:56626217-56626239 CTTGCTAAGTCAGTTTGTCAAGG + Intergenic
1042951650 8:74206294-74206316 CTTGCTAAGTGGCCGTGGGAAGG - Intergenic
1043526931 8:81107311-81107333 CTTGCTTGGTCCCCAGGTGAAGG - Intronic
1043684848 8:83072327-83072349 CTTGTATTGTCCCCTTGTGAGGG + Intergenic
1045543563 8:103108540-103108562 CTTGCTAAGTCCTCTCATGGTGG + Intergenic
1046998547 8:120550643-120550665 CATGTTAAATCCCCTTGTGTGGG - Intronic
1050742705 9:8840800-8840822 CTTGCTAAGTCCCACTGAAAGGG - Intronic
1056782149 9:89558754-89558776 CTTGCTGTGTCCTCATGTGATGG + Intergenic
1057910801 9:99019063-99019085 CCTGCTAAGTCCCCACGTTAGGG + Intronic
1059898076 9:118890954-118890976 CTTGCTAGGTCCTCATGTGTTGG - Intergenic
1060018048 9:120104355-120104377 CTTGGTAAGTCCAGTTTTGATGG + Intergenic
1060258773 9:122055626-122055648 CCTCCTATGTTCCCTTGTGATGG - Intronic
1185552176 X:991873-991895 CTAGCTAAGACCCCTGGTGTTGG - Intergenic
1185814645 X:3143726-3143748 CTTCCTGTGTCCCCCTGTGAAGG - Intergenic
1189268592 X:39735031-39735053 CTGGCTATGCCACCTTGTGAAGG - Intergenic
1189559394 X:42176804-42176826 CTTGCTAACTTCCCTTCTGCAGG - Intergenic