ID: 957322615

View in Genome Browser
Species Human (GRCh38)
Location 3:78651833-78651855
Sequence CCAATACCTGCTATGAAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957322612_957322615 -10 Left 957322612 3:78651820-78651842 CCAACAGGCTGCTCCAATACCTG 0: 1
1: 0
2: 1
3: 11
4: 142
Right 957322615 3:78651833-78651855 CCAATACCTGCTATGAAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 72
957322609_957322615 17 Left 957322609 3:78651793-78651815 CCAGATGCTGAAGACCATGAGGA 0: 1
1: 0
2: 0
3: 19
4: 225
Right 957322615 3:78651833-78651855 CCAATACCTGCTATGAAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 72
957322611_957322615 3 Left 957322611 3:78651807-78651829 CCATGAGGATGATCCAACAGGCT 0: 1
1: 0
2: 1
3: 5
4: 99
Right 957322615 3:78651833-78651855 CCAATACCTGCTATGAAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957322615 Original CRISPR CCAATACCTGCTATGAAGGC CGG Exonic
901153757 1:7122031-7122053 CCCATCCCTGCTCTGCAGGCCGG - Intronic
903499134 1:23792123-23792145 CCAGAAACTGCTGTGAAGGCTGG + Intronic
905311601 1:37052735-37052757 CAAATACCTACTATGAGGGGAGG + Intergenic
910059615 1:83073491-83073513 CAAAGGCCTGCTATCAAGGCGGG + Intergenic
915699169 1:157774345-157774367 TATATACCTGCTATGTAGGCTGG - Intronic
918573645 1:186028530-186028552 CCATTACGTGCTTTGCAGGCAGG + Intronic
1064273620 10:13886914-13886936 CAAATAATTGCTAAGAAGGCAGG + Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070981019 10:80647383-80647405 CCAACCCCTGCTTTCAAGGCTGG - Intergenic
1077273541 11:1692916-1692938 TCACTACCTGCTACGAAGACAGG + Intergenic
1079292747 11:19202935-19202957 CTAATATCTGATGTGAAGGCTGG - Intronic
1082224181 11:49682582-49682604 CAAATACTTGATATGAAGGATGG - Intergenic
1086624868 11:88936612-88936634 CAAATACTTGATATGAAGGATGG + Intronic
1090974862 11:131672133-131672155 CCCACACCTGCCAAGAAGGCCGG - Intronic
1091953593 12:4616358-4616380 CCAATACCTGCAATGAATTTTGG - Intronic
1096263652 12:50107739-50107761 TCACTACCTGCTATGGAGGGCGG + Exonic
1099318757 12:81118507-81118529 CCATCAGCTGCTAGGAAGGCTGG + Intronic
1102611750 12:114118424-114118446 CCTATTCCTTCTATGAAGGGTGG - Intergenic
1106596383 13:31143277-31143299 CCAATACCTACTGTGGAAGCAGG + Intronic
1117484632 14:56181991-56182013 CCAATACCTGGCATGATGCCTGG - Intronic
1130108628 15:80947396-80947418 CCAATTCCTGCTATTCAGACTGG + Intronic
1135026223 16:19001333-19001355 TCTATAACTTCTATGAAGGCAGG - Intronic
1138158061 16:54724704-54724726 CAAATTCCAGCTGTGAAGGCAGG + Intergenic
1144491551 17:15716533-15716555 CCTATACCTGCAATGAATGTGGG + Exonic
1144908933 17:18662672-18662694 CCTATACCTGCAATGAATGTGGG - Exonic
1148949861 17:51301333-51301355 CCAATCCCTGCTACAAAGACTGG + Intergenic
1152985211 18:314721-314743 ACAATCCCGGCTATGAAGGCAGG + Intergenic
1154148758 18:11888906-11888928 CCACTACTTACTATGAAGCCTGG + Intronic
1155369194 18:25080050-25080072 CCAGGAGCTGCTATCAAGGCAGG + Intronic
1156974906 18:43208718-43208740 CCAATACCAGGTATGAATCCAGG - Intergenic
1158261262 18:55608670-55608692 ATAATACCTTCTTTGAAGGCGGG - Intronic
1159133197 18:64305012-64305034 CTAACACCTTCTATGAAGGCTGG - Intergenic
1166972496 19:46578789-46578811 CCAAGACCAGCTAAGGAGGCAGG + Intronic
926903573 2:17784942-17784964 TCAACACCTGCTGTGCAGGCCGG - Exonic
947099092 2:226600183-226600205 CCAATCCCTGCCATGGAGGAAGG - Intergenic
1170144052 20:13153602-13153624 CCAATATCTGCTATGAAGTGTGG + Intronic
1170768712 20:19313734-19313756 CCAGGACCTGCTCTGAAAGCAGG - Intronic
1173119784 20:40278079-40278101 CCAAAAGCTGCTTTGAAGGTTGG - Intergenic
1173420497 20:42896824-42896846 CCAACAAATGCTTTGAAGGCAGG + Intronic
1177183122 21:17765060-17765082 ACAATGCCAGCCATGAAGGCTGG - Intergenic
953714024 3:45300735-45300757 CCAACTCCTGCTATGCAGGGAGG + Intergenic
953714446 3:45305830-45305852 CCAATTCCTGCTTCAAAGGCTGG - Intergenic
954317202 3:49807579-49807601 CCTCTTCCTGCTATGAAGCCAGG - Intronic
955691220 3:61592345-61592367 GCCATACTTGCTCTGAAGGCGGG - Intronic
957235802 3:77588825-77588847 CCAATACCAGCTATAAAGGCTGG - Exonic
957322615 3:78651833-78651855 CCAATACCTGCTATGAAGGCCGG + Exonic
961127672 3:124435155-124435177 GCAATGCCTCCTATGAAGGTTGG + Intronic
962499140 3:135971614-135971636 CCAATGACAGCTATGAAGTCTGG - Intronic
964633877 3:158840525-158840547 CCAGGCCCTGCTATGGAGGCTGG + Intergenic
966325057 3:178744750-178744772 CCAAGACCTGCAATGAACCCAGG + Intronic
970524394 4:16916818-16916840 CCATTACCTGCTATAAGGGCAGG - Intergenic
984974974 4:185222203-185222225 TGAATACCTGCCATGAAGGAGGG - Intronic
984974997 4:185222339-185222361 TGAATACCTGCCATGAAGGAGGG - Intronic
986983940 5:13479487-13479509 CCCATACCTGATTGGAAGGCAGG + Intergenic
994365377 5:98910372-98910394 CAAATAACTGCTATAAAGTCAGG + Intronic
995088267 5:108140919-108140941 ACAATACCTAGTTTGAAGGCAGG - Intronic
999120301 5:149204567-149204589 CCAATCCCTGTTCTGAAGCCAGG - Intronic
999424081 5:151471621-151471643 TCAATACCTGGAATGAAGACAGG - Intronic
1002601785 5:180357682-180357704 CCCATCCCTGTTATGAGGGCAGG + Intergenic
1007745792 6:44042345-44042367 CCCACACCTGCTACAAAGGCAGG + Intergenic
1014792958 6:125695372-125695394 CTTATACCTGCTAAAAAGGCAGG - Intergenic
1017997585 6:159546228-159546250 CCTATACCTTCTACAAAGGCTGG - Intergenic
1018800964 6:167221976-167221998 ACACTCCCTGCTATGCAGGCTGG - Intergenic
1022517572 7:30985701-30985723 CCACTAGCTGCAAGGAAGGCTGG + Intronic
1022594121 7:31695606-31695628 CCATTACCTGGTATGAAAGGTGG - Exonic
1023687527 7:42751902-42751924 CTAATAACTGCAAGGAAGGCTGG + Intergenic
1028251622 7:88544979-88545001 CTAATAGCTGCTTTGAAGCCTGG - Intergenic
1030134985 7:106238049-106238071 CCACTAAATACTATGAAGGCAGG - Intergenic
1031877303 7:127156273-127156295 CCCATAACTGCTACGAAGGTGGG - Intronic
1033365301 7:140668690-140668712 CTAATTCCTTCTTTGAAGGCTGG + Intronic
1037765998 8:21772631-21772653 CCACTCCCTGCCATGAGGGCTGG - Intronic
1040862362 8:52012633-52012655 CCAATACCTGCCATGAAGTCTGG - Intergenic
1044562296 8:93624988-93625010 CGAATGCCTGCTTTGAAGGCAGG + Intergenic
1044598887 8:93984250-93984272 CCATTACCTACTCTGTAGGCAGG - Intergenic
1051179471 9:14395428-14395450 CCAATACCAGCTCTGAGAGCTGG + Intronic
1059475555 9:114544164-114544186 CAAATACCTGCTTTGAAGATAGG - Intergenic
1059605391 9:115829220-115829242 TCAGTACCTAGTATGAAGGCTGG + Intergenic
1188694080 X:33167064-33167086 CCAATACCTGATAGGAGAGCAGG - Intronic
1189161890 X:38817699-38817721 CTAATAACTGCTATGATGGCTGG + Intergenic
1189452961 X:41156635-41156657 CCAGCACCTGCTCTTAAGGCAGG + Intronic
1190606999 X:52153959-52153981 CCAGTGCCTGCTATGAAGGCTGG - Intergenic
1190617462 X:52250628-52250650 CCAGTGCCTACTATGAAGGCTGG + Intergenic
1199394534 X:147319586-147319608 CCAATATATGCAATGAAGACGGG - Intergenic