ID: 957322622

View in Genome Browser
Species Human (GRCh38)
Location 3:78651893-78651915
Sequence ACTTGGTCCTCAGGTGACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957322618_957322622 6 Left 957322618 3:78651864-78651886 CCACATCTGAAATCTGCTGAGCG 0: 1
1: 0
2: 1
3: 7
4: 121
Right 957322622 3:78651893-78651915 ACTTGGTCCTCAGGTGACACAGG 0: 1
1: 0
2: 0
3: 9
4: 134
957322617_957322622 18 Left 957322617 3:78651852-78651874 CCGGCTGCTTCACCACATCTGAA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 957322622 3:78651893-78651915 ACTTGGTCCTCAGGTGACACAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957322622 Original CRISPR ACTTGGTCCTCAGGTGACAC AGG Exonic
902776098 1:18675972-18675994 ACTTGGTCCTGAGCGGACCCCGG - Intronic
906673694 1:47678031-47678053 GCTAGGTGCTCAGGAGACACAGG + Intergenic
907298802 1:53472282-53472304 ACTTTGTCCTCTGGTAACATTGG + Intergenic
909629506 1:77756781-77756803 ACTTGGACCTGAGATGACATGGG - Intronic
910657133 1:89631319-89631341 ACTTTGTACTCAGGTGAACCAGG - Intergenic
915405814 1:155658933-155658955 CCTTGGCCTTCAGGTAACACTGG + Intergenic
917574131 1:176302552-176302574 AGCTGGTCCTCAGGTAACCCAGG - Intergenic
917932288 1:179831004-179831026 ACTTCGACCTCAAATGACACTGG - Intergenic
921364182 1:214358228-214358250 ACCTGGTCATCATGTGTCACTGG + Intronic
924014283 1:239703185-239703207 TCTTGTTCCTCAGGTAACAGAGG + Intronic
1063092067 10:2874087-2874109 CCTTTTTCCCCAGGTGACACTGG - Intergenic
1065025264 10:21534663-21534685 ACCTCGTCCTCCAGTGACACGGG - Exonic
1065588235 10:27240828-27240850 AGTGGGTCCTCCGGTGACTCTGG - Intronic
1069789181 10:71008766-71008788 GGTGGGCCCTCAGGTGACACTGG - Intergenic
1070732550 10:78841361-78841383 ACTCGGTCCCCATGTCACACCGG - Intergenic
1073321274 10:102617639-102617661 ACTTGTGTCTCAGGTGACAGGGG - Intronic
1075670374 10:124260333-124260355 GCCAGGTGCTCAGGTGACACAGG - Intergenic
1077311444 11:1890649-1890671 CCTTGGACCACAGGAGACACAGG - Exonic
1078451295 11:11442848-11442870 ACATGGGCCTCAGGGGACACTGG + Intronic
1078887851 11:15523214-15523236 ACTTGGTCTCCAGACGACACTGG - Intergenic
1079478065 11:20851969-20851991 TCTTGGTCCTGAAGTGACAGTGG + Intronic
1079885585 11:25984213-25984235 ACTTTGTCTTCAAGTGACATTGG - Intergenic
1082058582 11:47841420-47841442 ACTTGGTTCACAGGCGCCACTGG + Intronic
1083890431 11:65593087-65593109 CCTTGGTCCTCAGCAGTCACAGG + Exonic
1084268676 11:68017736-68017758 GATTGGTCCACAGGAGACACAGG - Intronic
1086691155 11:89789377-89789399 GCTGGGTCCTCAGCTGACAGAGG - Intergenic
1086714647 11:90050278-90050300 GCTGGGTCCTCAGCTGACAGAGG + Intergenic
1087285453 11:96260290-96260312 AGTCTGTACTCAGGTGACACTGG + Intronic
1088291793 11:108246649-108246671 ACTTGGTCCTCATATGAAAGAGG + Intronic
1088530078 11:110798929-110798951 ACGAGGTCCTCAGGTGACCTTGG - Intergenic
1091635170 12:2191316-2191338 GCTTGGTCCTTAGGTGTCCCAGG + Intronic
1096183989 12:49566450-49566472 ACATGGTGCTCAGGTCAGACTGG + Intronic
1102668510 12:114597597-114597619 ACTTTCTCCTCAGGACACACTGG - Intergenic
1104096776 12:125565396-125565418 ACTTGGGCTTCAGGAGTCACAGG - Intronic
1104116834 12:125757737-125757759 ACTTGAACCTCAGGTCACAAAGG - Intergenic
1104645383 12:130493918-130493940 AGTTGGTGCTCAGGAAACACTGG - Intronic
1104809954 12:131614190-131614212 ACTTGGTCTGGAGGTAACACAGG - Intergenic
1106635088 13:31520059-31520081 AATTGCTCTCCAGGTGACACTGG + Intergenic
1115041926 14:28940950-28940972 ATTTGATCCCAAGGTGACACTGG - Intergenic
1118480907 14:66164543-66164565 ACCTGGTCCTGAGGTGACTAGGG + Intergenic
1119023772 14:71136719-71136741 ACTTGGGCTTCAGGGGTCACAGG - Intergenic
1119809014 14:77500536-77500558 ACTTGGTGCCCAGGTGAGAGGGG - Intergenic
1119882791 14:78114172-78114194 ACTTGCTCCTCAGGTGGCCTTGG + Intergenic
1122228489 14:100293126-100293148 GCTTGGTCCTCAGGAGCCCCTGG - Intronic
1130662710 15:85843228-85843250 ACTTGGTCATCAGATGCAACAGG + Intergenic
1132801915 16:1758722-1758744 TCCTGCTCCACAGGTGACACTGG + Intronic
1132905678 16:2281466-2281488 TCTTGGTCCTCAGGAAGCACAGG + Exonic
1141745222 16:85920991-85921013 ACTTGGGACTCACGTGGCACTGG + Intronic
1144688966 17:17246991-17247013 TCTTAGTCTCCAGGTGACACAGG + Exonic
1145277858 17:21445538-21445560 AACTGGTCCTCAGGTTACAACGG - Intergenic
1150384063 17:64743634-64743656 TCTTGGATCTCAGGTTACACAGG + Intergenic
1150772054 17:68050620-68050642 TCTTGGATCTCAGGTTACACAGG - Intergenic
1152279511 17:79376962-79376984 CCTTGGTCCTCAGGAGGTACTGG - Intronic
1152736349 17:81999199-81999221 GCCTGGCCCTCAGGGGACACAGG - Intronic
1162026738 19:7898648-7898670 TTTTGCTCCTCAGGTGACACAGG + Exonic
1168147459 19:54427992-54428014 ACTTGAGCCTCAGGGGACAGAGG - Intronic
926066301 2:9843218-9843240 ACTTGCTCCTCCGGCGGCACGGG - Intergenic
928918697 2:36502795-36502817 ACTTGGTGCTCAGCAGATACTGG + Intronic
931900332 2:66781381-66781403 ACTTGCTCCTTAGGTAACACAGG - Intergenic
933835612 2:86243097-86243119 ACCAGGTCATCAGGTGACAGCGG + Intronic
934118968 2:88822290-88822312 ACTGGGGCCTGAGGTCACACAGG + Intergenic
938079701 2:128363166-128363188 ACTTGCTCCACAGGGGACTCAGG + Intergenic
938164251 2:129012109-129012131 ACTTCGTCCCCAGTTGAAACTGG - Intergenic
944621343 2:201518566-201518588 TCTTAGTCCTCAGGTGTCAGTGG + Intronic
947809840 2:232997405-232997427 GCGGGGTCCTGAGGTGACACAGG + Intronic
948008612 2:234632462-234632484 CTTTGGTTCTCAGGTGAAACCGG - Intergenic
948747399 2:240106683-240106705 AATAGCTCCTCAGGTGCCACAGG + Intergenic
1170075055 20:12410265-12410287 ACAGGGTCCTCAGGTGAGCCAGG - Intergenic
1172351613 20:34247233-34247255 ACATGGTCCTCAATTGAAACAGG + Intronic
1173524374 20:43720752-43720774 ACTTGGTGCTCAGATAACATGGG + Intergenic
1174035568 20:47666341-47666363 TCTTGGTCCTCAGGGGCCCCTGG + Exonic
1174634570 20:51987892-51987914 AGTGGGTCCTCAGTAGACACTGG + Intergenic
1174724866 20:52851069-52851091 ACTGGTTCTTCAGGTGAGACAGG - Intergenic
1175331638 20:58168649-58168671 ACATGGTCCTCTGGTGGCTCTGG - Intergenic
1178422909 21:32456409-32456431 ACTTGGCCCACAGATGTCACCGG - Intronic
1179981477 21:44898065-44898087 CCTGGGGCCTCAGGTCACACCGG + Intronic
1180613646 22:17113683-17113705 ACTCTGTCCTCAGGTGCCCCGGG - Exonic
1181275748 22:21686659-21686681 ACTAGGGGCTCAGGTGACAGTGG - Intronic
1181962455 22:26632552-26632574 ACTTAGTCTTCAAGTGAAACAGG - Intergenic
1183386929 22:37519971-37519993 CCCTGGTCCTCAAGTGCCACGGG - Intergenic
1185131997 22:49044585-49044607 ACATGGGCCTCAGGTCACATTGG - Intergenic
949125899 3:444969-444991 ACTGGATCCTGAGGTGGCACAGG - Intergenic
952820598 3:37482678-37482700 TCTGGGTACTGAGGTGACACAGG + Intronic
954405978 3:50345313-50345335 ACCTGATCCTGAGGGGACACAGG + Intronic
957322622 3:78651893-78651915 ACTTGGTCCTCAGGTGACACAGG + Exonic
958063262 3:88510014-88510036 GATTGGTCCACAGTTGACACTGG - Intergenic
958465716 3:94455125-94455147 ACTTGGTTTTCAGGTGCTACAGG - Intergenic
961057469 3:123801235-123801257 ACTTGGACCTCAAGGGACCCTGG + Intronic
963792770 3:149601321-149601343 TCTGGGACCACAGGTGACACAGG + Intronic
967770545 3:193329720-193329742 GCTTGGTCCCCAGGTGAAAGGGG - Intronic
967987842 3:195108133-195108155 ACTTGCAGCTCAGGTGACCCAGG - Intronic
968230992 3:197004292-197004314 ACTAGGCCCGCAGGTGCCACTGG + Intronic
968448755 4:665382-665404 TCTTGGTCCTCAGGAGCCTCAGG + Intronic
971591527 4:28474811-28474833 ATTTTATCCTCAGGTGACAGAGG - Intergenic
972716069 4:41647417-41647439 ACTTGGTCCTCAAATGAGACAGG + Intronic
974019239 4:56678235-56678257 ACTTGGTGGTCAGGTGGCATGGG + Intronic
977441234 4:97070549-97070571 ACTTGGGCTTCAGGAGTCACAGG + Intergenic
977564739 4:98569374-98569396 CCTTGGTCCTCAGGGGACCAAGG + Intronic
980024435 4:127748417-127748439 ACTTGGTCCATGGGTGACAGGGG - Intronic
980981112 4:139655293-139655315 ATTTTGTCCTCAGGGGACATTGG - Intergenic
982403886 4:154999339-154999361 CCTAGGTCCTCAGGGTACACAGG - Intergenic
985893013 5:2730778-2730800 ATTTTGTTCTCAGGAGACACAGG - Intergenic
985994686 5:3591405-3591427 TCTTGGTCCCCAGGGGCCACCGG + Intergenic
986718292 5:10539674-10539696 ACATGGTCAGCAGGTGAAACAGG + Intergenic
987135054 5:14892620-14892642 CCTTGGTCCTAAGCTGGCACTGG - Intergenic
991618260 5:68518612-68518634 GTTTGGTCCTGAGGTAACACTGG + Intergenic
992296281 5:75330141-75330163 TCTTGGACCACAAGTGACACTGG + Intergenic
994664737 5:102693408-102693430 TCTTGGCCTTCAGGTAACACCGG - Intergenic
997382444 5:133447270-133447292 ACTTGGGCATCAGGTGACCTGGG - Intronic
997606955 5:135182084-135182106 ACTTGTACATCAGGTGACTCAGG + Intronic
999412213 5:151360807-151360829 TCTTCCTCCTCAGCTGACACCGG + Intergenic
1002430805 5:179202860-179202882 CCTTGGTCCACAGGTGACCCAGG + Intronic
1005561313 6:27044699-27044721 ATTTGATCCTAAGGTGACAGGGG + Intergenic
1010795551 6:80113286-80113308 CCTTGGCCTTCAGGTAACACTGG + Intronic
1014305653 6:119738266-119738288 ACTTAGTCTTCAGGTGAGAAAGG + Intergenic
1014600144 6:123401370-123401392 ACTTAGTCCTCAGATTAAACAGG + Intronic
1017010124 6:150057848-150057870 ACTTGGTCCTTAGGGTCCACGGG + Intergenic
1017912912 6:158810104-158810126 GTTTGATCCTCAGGTGATACTGG + Intronic
1018551765 6:165006595-165006617 AGTTGGGCCTCAGGTGACAGAGG + Intergenic
1023050397 7:36246175-36246197 GCTGGGCCCTCAGGAGACACAGG + Intronic
1028644230 7:93077120-93077142 TCTTTGACCTCAGGTGGCACTGG - Intergenic
1029506932 7:100968448-100968470 CCTTTGTCCCCAGGAGACACAGG - Intergenic
1032275700 7:130453416-130453438 ACTTTGTCCTCAGCCCACACTGG - Intergenic
1033881262 7:145886903-145886925 ACTTGGGCTTCAGGAGTCACAGG - Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1037618416 8:20542345-20542367 ACTGGGCTATCAGGTGACACCGG + Intergenic
1037766044 8:21772932-21772954 ACTGCGTGCACAGGTGACACTGG - Intronic
1037817365 8:22119248-22119270 TCTTGGTCCCCAGGTGTCCCCGG + Exonic
1046383567 8:113480535-113480557 CCTTGGCCTTCAGGTAACACTGG + Intergenic
1046730708 8:117722982-117723004 ACTTTCTCCTCAGGTCTCACTGG + Intergenic
1048531459 8:135253887-135253909 ACTTGGGCTTCAGGAGTCACAGG + Intergenic
1048797896 8:138168135-138168157 ACTCGGTTCTCAGCTGACTCTGG + Intronic
1049270791 8:141695009-141695031 AGGTGGTGCTCAGGTCACACTGG + Intergenic
1053269554 9:36740560-36740582 ATTTGGTCCTCAGCAGACCCTGG - Intergenic
1061746405 9:132743304-132743326 ACTTGTCCCCCAGGTGACCCAGG - Intronic
1061806849 9:133141604-133141626 CCCTGGTCCTCAGGTGAGGCAGG - Intronic
1185802369 X:3024567-3024589 ACCTTGTCCCCAGGGGACACTGG - Intronic
1185825948 X:3249864-3249886 ACTTTGCCCTCAGGGGACACTGG + Intergenic
1188906962 X:35801308-35801330 ACTTCCTTCTCAGGTGACTCAGG + Intronic
1190957411 X:55209047-55209069 ACTTAGACCTCAGGTGAGACTGG - Intronic
1196383899 X:115126835-115126857 ACTTGTACCTCAGATGATACTGG + Exonic
1198642620 X:138773332-138773354 ACTGGGTCCTCAGAGGACAAAGG + Intronic
1200660609 Y:5952015-5952037 TGTGGGTCCACAGGTGACACTGG - Intergenic
1201253054 Y:12079981-12080003 ACTTTGCCCTCAGGGGACACTGG - Intergenic