ID: 957330557

View in Genome Browser
Species Human (GRCh38)
Location 3:78758039-78758061
Sequence GGCTGAGCAGACTCTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957330557_957330561 14 Left 957330557 3:78758039-78758061 CCCTTGGGAGAGTCTGCTCAGCC 0: 1
1: 0
2: 0
3: 20
4: 157
Right 957330561 3:78758076-78758098 ACAAAGTTTAAGACCTCCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957330557 Original CRISPR GGCTGAGCAGACTCTCCCAA GGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901602639 1:10433746-10433768 GGCTGAGCAGACCCTCTCCTTGG + Intronic
902048982 1:13547016-13547038 GGCTCAGCAACGTCTCCCAAGGG + Intergenic
902650479 1:17833975-17833997 GGCTGAACGGACCCTCTCAAGGG - Intergenic
903859213 1:26354923-26354945 GCCTTAGCAGCCTCTCCCTAGGG - Intergenic
904438367 1:30513971-30513993 GCCAGAGCAGCCCCTCCCAAAGG + Intergenic
904565958 1:31428650-31428672 GGCTGGGCAGACTCTCCAGACGG + Intronic
906684184 1:47752385-47752407 GGCTGAGCCAACTCTCCCAGCGG - Intergenic
907248474 1:53122669-53122691 GTCTCAGCACACCCTCCCAAGGG + Intronic
912041806 1:105399298-105399320 GGCTGAGAAGCCTCTCCCTGTGG + Intergenic
912633206 1:111267261-111267283 GGCAGAGGAGTCTCTCCCCATGG + Intergenic
912692487 1:111814877-111814899 GGCTGAGCAGACACATCCTAGGG - Intronic
915086864 1:153394994-153395016 GGCAGAGGAGACCCTCCCTAAGG + Intergenic
915087904 1:153400448-153400470 GCCTGTGCAGGCCCTCCCAAGGG - Intergenic
916341776 1:163744971-163744993 GGCAGAGGAGTCTCTCCCAGTGG + Intergenic
918691790 1:187489778-187489800 GGCTACCCAGACTTTCCCAAGGG + Intergenic
919728469 1:200898554-200898576 GGCTGGGCTGAGACTCCCAAGGG + Intronic
920377931 1:205519233-205519255 TGAGGAGCTGACTCTCCCAAGGG + Intronic
923272730 1:232372532-232372554 GGATGAGCAGCTTCTCCAAATGG + Intergenic
923338281 1:232987962-232987984 GGCTGAGCACACTCATCCCAGGG - Intronic
1063683770 10:8216031-8216053 GCCTGTGCATGCTCTCCCAATGG - Intergenic
1065129328 10:22604729-22604751 TGCTGAGTAGAGTCTCCCACCGG - Intronic
1067752843 10:48983330-48983352 GGCTCAGCAGTCTCTTCCCAGGG + Intergenic
1067766407 10:49090804-49090826 GGGTGATGAGACTGTCCCAAGGG - Intronic
1070592502 10:77811021-77811043 GGCTGAGCACATTCTCCAAGTGG - Intronic
1071351467 10:84750335-84750357 GGCTGACTGGACCCTCCCAAGGG - Intergenic
1071477354 10:86036236-86036258 GGCTGGGCAGACTCTCCATGAGG + Intronic
1075068634 10:119306302-119306324 GGCTGAACAGACTCACACAGAGG - Intronic
1075643708 10:124084159-124084181 GGAGGAGCTGACCCTCCCAAGGG + Intronic
1076982355 11:211363-211385 GGCTGTGCAGGCTCCCCCAGTGG + Intronic
1077564840 11:3290967-3290989 GGCTCAGGAGAGTCTTCCAACGG + Intergenic
1077570730 11:3336784-3336806 GGCTCAGGAGAGTCTTCCAACGG + Intergenic
1081871576 11:46384925-46384947 GGCTGAGGAGGCTCACCCCAGGG - Intergenic
1085194680 11:74661937-74661959 GGCCGAGGAGCCTCTCCCAATGG + Intronic
1088402527 11:109436790-109436812 GGCTGAGCAGACTCCACCGAAGG - Intergenic
1089392753 11:118113209-118113231 GCCTGAGGAGACTTTGCCAAAGG - Intronic
1089461948 11:118658804-118658826 GGCAGAGCAGCTTCTCCCCAGGG - Intronic
1090743846 11:129691562-129691584 AGCTGAGCACACTCTTCCCAAGG - Intergenic
1092317743 12:7437598-7437620 TTCTGAGCAGACTATCACAAGGG - Intronic
1093903252 12:24660855-24660877 GGCAGAGGAGTCTCTCCCCATGG + Intergenic
1096139716 12:49233101-49233123 GTCTGAGCGGACTCTCTCCAGGG + Intronic
1098060375 12:66554787-66554809 GGCAGAGGAGCCTCTCCCCATGG - Intronic
1100603733 12:96133870-96133892 TGCTTAACAGACTTTCCCAAAGG - Intergenic
1100946450 12:99788857-99788879 GGCAGAGGAGACTCTCCCTGTGG - Intronic
1107420897 13:40245341-40245363 GGCTGCTCAGAATCTGCCAATGG - Intergenic
1107888471 13:44893963-44893985 GGCTCAGAAGTCTCTCCCCATGG + Intergenic
1107936701 13:45351493-45351515 GGCAAAGCAGATTCTCACAATGG + Intergenic
1113275993 13:108730667-108730689 GGCTAAGCAGCATCTTCCAAAGG + Intronic
1114039892 14:18668043-18668065 TGCAGAGCAGAGTGTCCCAAGGG - Intergenic
1116458399 14:45144590-45144612 GGCAGAGGAGCCTCTCCCCATGG + Intronic
1119458991 14:74782150-74782172 GGCAGAGCAGACTTGCTCAAAGG - Exonic
1119668650 14:76501926-76501948 GGCTGGGTTGCCTCTCCCAACGG - Intergenic
1121244169 14:92450528-92450550 TGCTGAGCAGACTACCCCAGGGG + Intronic
1123149092 14:106164470-106164492 GTCTCAGCAGCCTCTCCCAATGG + Intergenic
1123898099 15:24848377-24848399 GGCTGATAAGACACTCCCAGCGG - Intronic
1125355188 15:38810187-38810209 GGCTCTACAGACTCTCCAAAAGG + Intergenic
1125484041 15:40100176-40100198 GGGACAGAAGACTCTCCCAAGGG + Intronic
1126749258 15:51860013-51860035 GGCAGTGAAGACTCTGCCAAGGG - Intronic
1129180139 15:73869022-73869044 GAATGAGCAGAGTCTCCCAGTGG - Intergenic
1129375374 15:75126896-75126918 GGCTGAGCAGACTGTAACAAGGG + Intergenic
1129480507 15:75821459-75821481 AGCTCAGCAGATTCTCACAATGG - Intergenic
1129657379 15:77533345-77533367 GGCAGAGCAGAGCCTTCCAAAGG + Intergenic
1129993224 15:79982794-79982816 GCCAAAGCAGATTCTCCCAATGG - Intergenic
1132657402 16:1046983-1047005 GGCAGACCACCCTCTCCCAAGGG - Intergenic
1132745567 16:1434810-1434832 GCCGGAGCACACTCTCCCACAGG + Exonic
1134010109 16:10845739-10845761 GGCTGAGCAGACTGATGCAAAGG - Intergenic
1136369177 16:29825318-29825340 GGCTGGGCAGAGCCTTCCAAAGG + Intronic
1136681127 16:31963087-31963109 GTCTCAGCAGCCTCTCCCAATGG - Intergenic
1136781443 16:32904599-32904621 GTCTCAGCAGCCTCTCCCAATGG - Intergenic
1136888354 16:33949241-33949263 GTCTCAGCAGCCTCTCCCAATGG + Intergenic
1138584792 16:57962746-57962768 GCCTGGGCAGAGGCTCCCAAGGG + Intronic
1139249587 16:65482019-65482041 TGCCCAGGAGACTCTCCCAAAGG + Intergenic
1139672273 16:68499848-68499870 GCCTGAGCAGACCATCCCAGGGG + Intergenic
1203084095 16_KI270728v1_random:1168581-1168603 GTCTCAGCAGCCTCTCCCAATGG - Intergenic
1144669006 17:17120980-17121002 GACTGAACAGACTCAACCAATGG - Intronic
1144996539 17:19273241-19273263 GGCTGAGCAGACCCACAGAATGG - Intronic
1146399890 17:32494212-32494234 GGGTGAGCAGAGTCACCCACAGG - Exonic
1146750443 17:35373703-35373725 GGCTTAGCAGACCCGCCCATTGG - Intergenic
1147198630 17:38784323-38784345 GGCTGGGCAGGTTCTCCCTAGGG + Exonic
1148019387 17:44543290-44543312 GGCTCAGCAGGCTCTCTCTAAGG + Intergenic
1148231032 17:45935189-45935211 GGCTGCCCAGACTCTCCCGAGGG - Intronic
1148404916 17:47402957-47402979 GGATGAGCAGACTCTACTCAAGG + Intronic
1149231318 17:54537352-54537374 GGCAGAGGAGCCTCTCCCCATGG - Intergenic
1150009775 17:61492977-61492999 GGCAGAGCTGACTCACCCACAGG - Intergenic
1151205372 17:72502549-72502571 GCCTGAGCAGCCTCTCTCCAAGG + Intergenic
1151749202 17:76027166-76027188 GGCTGAGCAAAGGCTCCCAGGGG - Exonic
1152074549 17:78150810-78150832 GGCTGAGCCTACACTCCAAACGG + Intronic
1156977208 18:43237595-43237617 GGCAGAGGAGCCTCTCCCTATGG + Intergenic
1157937024 18:51884277-51884299 GGCAGAGGAGTCTCTCCCCAGGG - Intergenic
1158446923 18:57529887-57529909 GGCTGGGCAGACATCCCCAAAGG - Intergenic
1160405749 18:78645288-78645310 GGCTGAGCAGATCTTCCCACGGG + Intergenic
1162520150 19:11174813-11174835 GGAAGTGCAGACCCTCCCAAAGG + Intronic
1164456511 19:28411891-28411913 GGGTGAGCAGACTATACCAGGGG - Intergenic
1164706626 19:30324877-30324899 TGCTGAGCTGGCTCTCCCTAGGG + Intronic
1165177258 19:33939325-33939347 TGCTGTGCACACTCACCCAAGGG + Intergenic
1165313878 19:35043272-35043294 GGCTGCCCAGAGACTCCCAAGGG - Intronic
1166213628 19:41322467-41322489 GTCAGAGCTGACCCTCCCAAGGG - Intronic
1167687129 19:50963348-50963370 GGCTGAGCAGTCCCTCTCCAGGG + Exonic
927461004 2:23298096-23298118 GGCTCTGCAGCCTCTCCCCAGGG - Intergenic
928593103 2:32837246-32837268 CGCTGAGCACACTGTCCAAAAGG + Intergenic
930058416 2:47269678-47269700 GGCAGAGCAAACTGTTCCAAAGG + Intergenic
930778314 2:55197091-55197113 GGCAGAGGAGTCTCTCCCTACGG - Intronic
936046414 2:109191528-109191550 GCCTGAGCAGACTCTCAGGAGGG - Intronic
938128781 2:128693395-128693417 AGCTGGGCAGACTCTTCCCAGGG - Intergenic
940795449 2:158072222-158072244 GGCAGAGGAGGCTCTCCCAGTGG - Intronic
942834462 2:180277222-180277244 GGCTGAGGAGCCTCTCCCTGTGG + Intergenic
944670156 2:201987713-201987735 GGCTGAGCAGCCTTTCCCCAGGG + Intergenic
948263751 2:236622815-236622837 GGCTGAGCACACAGTCCCAAGGG - Intergenic
948272734 2:236686860-236686882 GGCTGAGCAGTCCCTCCAGATGG + Intergenic
1169617920 20:7471086-7471108 GGCTGAGGAGCCTCACCCCATGG + Intergenic
1170236084 20:14106292-14106314 GGCAGAGGAGACTCTCCCTGTGG - Intronic
1179438026 21:41375343-41375365 GCCTGAGCAGACTCATACAAGGG - Intronic
1180059349 21:45376587-45376609 GGATGAGCAGACCCTGCCCAGGG + Intergenic
1184430995 22:44441529-44441551 AGGTCAGCAGACGCTCCCAAGGG + Intergenic
949776438 3:7637830-7637852 TTCTGAGCAGCCTCTCCCACAGG + Intronic
949798070 3:7872564-7872586 GCCTGAGCAGACTAACACAAAGG + Intergenic
950469618 3:13176440-13176462 GGTGGAGCAGAGGCTCCCAAGGG - Intergenic
952828050 3:37540242-37540264 TGCTGAGCAGACTCTCCTCGGGG - Intronic
954317792 3:49810702-49810724 GGCTGGGCTGGCTCTCCCAAAGG + Intronic
955662484 3:61316106-61316128 GTCTGAGCAAACTCCCCCAAGGG - Intergenic
957330557 3:78758039-78758061 GGCTGAGCAGACTCTCCCAAGGG - Intronic
957810404 3:85214706-85214728 AGCAGAGCAGTCTCTCCCCATGG + Intronic
957813417 3:85258116-85258138 GGCTGAGCTGCCTCACACAAGGG - Intronic
960772294 3:121208211-121208233 TTCTCAGCAGACTATCCCAAGGG + Intronic
963710332 3:148739806-148739828 GGCTGAGCATTCTCTTGCAATGG - Intronic
968479781 4:827947-827969 TCCTGTGCAGACTGTCCCAAAGG - Intergenic
968540724 4:1167050-1167072 TGCTGAGCCCACTCTCCCGAGGG - Exonic
974893203 4:67907066-67907088 GGCAGAGGAGACTCACCCCATGG + Intergenic
978682557 4:111399473-111399495 CGCTGAGCAGACTCACCAAATGG - Intergenic
979277194 4:118827639-118827661 GGCTGGCCAGAGTCTCCCAGAGG - Intronic
981557407 4:146009805-146009827 TGCTCTGCAGACTCTCCCAAGGG - Intergenic
988738827 5:34049375-34049397 GGCTGAGCAGACTAGCCCTGGGG - Intronic
989657672 5:43761819-43761841 GGCAGAGGAGTCTCTCCCCATGG + Intergenic
995077684 5:108006036-108006058 TGCTGAGCACACTGTGCCAAGGG + Intronic
997431364 5:133843397-133843419 GACTGAAGAGACTCTCCCACTGG - Intergenic
998463738 5:142326684-142326706 GGCAGAGCAGACTCTCCCCTAGG + Intergenic
1002213241 5:177610610-177610632 GGCTGAGGAGATTCACCCACAGG + Intergenic
1003241944 6:4352716-4352738 GGCTGAGAAGGTTCTCCCATTGG + Intergenic
1005581768 6:27241980-27242002 GGCAGGGCAGACGCTCACAAAGG - Intergenic
1005798247 6:29391051-29391073 GGCTGAGTAGACCTTCCCATGGG + Intronic
1006018530 6:31102798-31102820 GGCAGAGGAGCCTCTCCCTATGG + Intergenic
1006603309 6:35239873-35239895 GGGTGAGCAGACTCAGCCAAAGG + Exonic
1008822491 6:55650790-55650812 GGCAGAGGAGCCTCTCCCTATGG + Intergenic
1010838870 6:80623650-80623672 GGCAGAGAAGACTCTCCCTGTGG - Intergenic
1011102879 6:83743860-83743882 GGCTGAGGAGCCTCTCCATATGG + Intergenic
1011322790 6:86115692-86115714 GGCAGAGGAGCCTCTCCCCATGG + Intergenic
1012793627 6:103733759-103733781 TGCTGAGCACACACTCCCACTGG + Intergenic
1016425876 6:143935188-143935210 GGCTGAGCAGACTCACCCTCAGG + Intronic
1024329220 7:48139758-48139780 GGCTGAGCAAAATCTGCTAATGG + Intergenic
1027604939 7:80288366-80288388 AGCAGAGCAGTCTCTCCCCATGG - Intergenic
1029557292 7:101279233-101279255 ATCTGAGCAAACTCCCCCAAAGG - Intergenic
1029705195 7:102272411-102272433 GGCTGTGCAGCCTACCCCAAAGG + Intronic
1031851667 7:126872208-126872230 GGATGAGCAAACTCTTCAAAGGG + Intronic
1033313744 7:140281223-140281245 GGCTAAGCACAGTCTCCCCAAGG + Intergenic
1035104536 7:156430945-156430967 GGGTGAGCAGGCGTTCCCAAAGG - Intergenic
1038244282 8:25840263-25840285 GGCTGAGCAACCTCTCCAACAGG + Intergenic
1041324711 8:56652159-56652181 GGCAGTGCAGATTTTCCCAAAGG + Intergenic
1042980305 8:74519073-74519095 GGCAGAGGAGTCTCTCCCCATGG - Intergenic
1049759991 8:144327589-144327611 GGCTGAGAAGACACCACCAAGGG - Intergenic
1050869199 9:10545117-10545139 GGCAGAGCAAACTCCCACAAGGG + Intronic
1052347435 9:27424647-27424669 GGGTGCGCAGACTCTACAAAGGG + Intronic
1053670778 9:40359166-40359188 GGCTGAGCCCCCTCTCCCAGGGG - Intergenic
1054381898 9:64499228-64499250 GGCTGAGCCCCCTCTCCCAGGGG - Intergenic
1054513836 9:66017135-66017157 GGCTGAGCCCCCTCTCCCAGGGG + Intergenic
1056457149 9:86771663-86771685 GCCAGAGCAGACTCTCCACAGGG + Intergenic
1060304545 9:122398796-122398818 GGCAGAGGAGTCTCTCCCCATGG - Intergenic
1060899955 9:127248446-127248468 TGCAGATCAGACTCTCCCACAGG + Intronic
1062230881 9:135480581-135480603 GGCTGGGCAGGGTCCCCCAAGGG - Intronic
1186331716 X:8541583-8541605 GGCTGAGAACACCCTCCCACAGG - Intronic
1187844980 X:23525451-23525473 AGCAGAGCAGCCTCTCCCTATGG - Intergenic
1191700708 X:64038756-64038778 GGCTGAGAAGTATCTCCCAGTGG - Intergenic
1193738174 X:85185577-85185599 AGCAGAGCAGTCTCTCCCTATGG + Intergenic
1194288481 X:92039465-92039487 GGCAGAGGAGCCTCTCCCAGTGG + Intronic
1195593156 X:106655604-106655626 TTCTGAGCAAACTATCCCAAGGG - Intronic
1196736104 X:118982180-118982202 GGCTGAGCTTACTCTCCTAGGGG - Intronic
1199457345 X:148043988-148044010 AGCAGAGGAGACTCTCCCCATGG + Intergenic
1200606000 Y:5264030-5264052 GGCAGAGGAGCCTCTCCCAGTGG + Intronic
1201430900 Y:13901035-13901057 GGCTGAGAACACCCTCCCACAGG + Intergenic