ID: 957332998

View in Genome Browser
Species Human (GRCh38)
Location 3:78790471-78790493
Sequence AATAACTAAGAGAGTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3225
Summary {0: 4, 1: 109, 2: 564, 3: 1103, 4: 1445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957332998_957332999 22 Left 957332998 3:78790471-78790493 CCAGTTATACTCTCTTAGTTATT 0: 4
1: 109
2: 564
3: 1103
4: 1445
Right 957332999 3:78790516-78790538 TATTCAATACCATCACCCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957332998 Original CRISPR AATAACTAAGAGAGTATAAC TGG (reversed) Intronic
Too many off-targets to display for this crispr