ID: 957332999

View in Genome Browser
Species Human (GRCh38)
Location 3:78790516-78790538
Sequence TATTCAATACCATCACCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957332998_957332999 22 Left 957332998 3:78790471-78790493 CCAGTTATACTCTCTTAGTTATT 0: 4
1: 109
2: 564
3: 1103
4: 1445
Right 957332999 3:78790516-78790538 TATTCAATACCATCACCCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957332999 Original CRISPR TATTCAATACCATCACCCTG TGG Intronic
900855088 1:5175006-5175028 TTCTTAATACCATCACCTTGGGG - Intergenic
901216497 1:7558280-7558302 GATTCAATACCAACATGCTGCGG + Intronic
907398299 1:54207901-54207923 GATCCATTACCATCACACTGTGG + Intronic
907464009 1:54623285-54623307 TAGTCCTTGCCATCACCCTGCGG - Exonic
907964186 1:59313247-59313269 TTTTTAATACCATCACCTTAGGG + Intronic
908443075 1:64174300-64174322 TATTTAACACCATGATCCTGTGG - Intronic
908790297 1:67774502-67774524 GGTTCAAGGCCATCACCCTGTGG - Intronic
909702043 1:78536286-78536308 TAAACAATAGCATCACTCTGTGG + Intronic
911631231 1:100185710-100185732 TTCTTAATACCATCACCTTGGGG + Intergenic
911691301 1:100837715-100837737 CTTCCAATACCATCACCTTGTGG + Intergenic
912164881 1:107031165-107031187 TTCTTAATACCATCACACTGGGG - Intergenic
912351004 1:109012996-109013018 TTTCCAATACCATTACCTTGCGG - Intronic
914807551 1:151002596-151002618 CATGGAATACCATCAGCCTGAGG - Exonic
917000127 1:170348448-170348470 TATTCAATATCATTCCTCTGTGG - Intergenic
917835271 1:178936980-178937002 TAATAAATACCATCACACTGGGG + Intergenic
920171871 1:204077003-204077025 TTTTCTATCACATCACCCTGTGG - Intronic
921804871 1:219442703-219442725 CATTCAATATCATCAACCAGAGG + Intergenic
923438467 1:233992640-233992662 TTCTCAATGCCATCACACTGGGG + Intronic
923492035 1:234492600-234492622 TTTCTAATACCATCACCTTGAGG + Intergenic
924760612 1:246981694-246981716 TTTTCTATACCATCACCATCAGG - Intronic
1065710557 10:28513092-28513114 CTTCCAATACCATCACCTTGTGG - Intergenic
1066338179 10:34501894-34501916 CATCCTATACCATCACCTTGGGG - Intronic
1068295212 10:55062132-55062154 CTTTTAATACCATCACCTTGGGG - Intronic
1069478227 10:68756288-68756310 GATTCGCTACCATCGCCCTGAGG + Exonic
1073897589 10:108181306-108181328 TATTTAAAATCTTCACCCTGGGG + Intergenic
1074526712 10:114269244-114269266 TCTTCACAACCATCAGCCTGTGG - Intronic
1075825266 10:125351371-125351393 TACTAAATACCATGGCCCTGAGG - Intergenic
1077736158 11:4793829-4793851 TGTTCAATACCATCACCTGTGGG - Intronic
1078863816 11:15278170-15278192 TACACTATCCCATCACCCTGAGG + Intergenic
1080133580 11:28826121-28826143 ATTTAAATACCATCACACTGGGG + Intergenic
1086075765 11:82850223-82850245 TGTTCCATGCCATTACCCTGAGG - Intronic
1086820978 11:91435861-91435883 TATTCAATAGTGACACCCTGTGG - Intergenic
1087429429 11:98033644-98033666 CTTCCAATACCATCACCTTGGGG - Intergenic
1089312491 11:117568810-117568832 GATTCAATGCCATCACCATCAGG + Intronic
1089748258 11:120632087-120632109 TTCTTAATACCATCACACTGGGG - Intronic
1091316025 11:134614687-134614709 TACTTAATACCATCACCTTGGGG - Intergenic
1091667645 12:2430826-2430848 TGCTCAATGCCATCAGCCTGTGG - Intronic
1091892764 12:4073645-4073667 CACTAAATACCATCACACTGAGG - Intergenic
1093747476 12:22759712-22759734 TTTTCCATACCATCTCCCTCTGG - Intergenic
1094378991 12:29822155-29822177 TTTTTAATACCACCACCTTGGGG + Intergenic
1095608861 12:44103345-44103367 TAATCAGTACCATTACTCTGGGG + Intronic
1097124020 12:56758962-56758984 TCTTCAAGTCCATCTCCCTGAGG + Intronic
1097452062 12:59748899-59748921 TATTTAATACCAGCAAACTGTGG + Intronic
1101734541 12:107453338-107453360 CTTTTAATACCATCACCTTGGGG - Intronic
1102709051 12:114909156-114909178 TATTCTATGCCTTCAACCTGTGG - Intergenic
1103751028 12:123161206-123161228 TATTCAAAATCATTCCCCTGTGG + Exonic
1106068895 13:26387558-26387580 TACTCTCTATCATCACCCTGGGG - Intronic
1107363539 13:39645467-39645489 ACTTCAATACCATCACCTTGGGG + Intergenic
1108780988 13:53833147-53833169 TTTTCAATACCCTTTCCCTGAGG + Intergenic
1112884048 13:104147126-104147148 CTTTTAATACCATCACCTTGTGG + Intergenic
1116056859 14:39874705-39874727 TTTTAAATACCATCACCTTTGGG - Intergenic
1117679185 14:58185707-58185729 CTTTTAATACCATCACCTTGGGG - Intronic
1117738847 14:58794592-58794614 TGTACACTACCACCACCCTGAGG - Intergenic
1118289557 14:64506689-64506711 TATTCAATACCATGAAAATGTGG - Intronic
1118450678 14:65898662-65898684 CATCTAATACCATCACCTTGAGG - Intergenic
1119181380 14:72607495-72607517 CTTCTAATACCATCACCCTGAGG + Intergenic
1119271446 14:73308697-73308719 TATTTAAAGCCATCACACTGTGG + Intronic
1119915916 14:78401475-78401497 TTTTTAATACCATCACAATGAGG + Intronic
1120071358 14:80107174-80107196 TATTCCTCACCTTCACCCTGTGG - Intergenic
1120500363 14:85289486-85289508 CTTTTAATACCATCACCTTGCGG + Intergenic
1124031473 15:26016209-26016231 TAGGCAATACCAACTCCCTGGGG - Intergenic
1127610899 15:60635291-60635313 AATACACTACCATCACCCTAAGG - Intronic
1131631436 15:94181099-94181121 TCTTCTGTAACATCACCCTGTGG - Intergenic
1134683224 16:16141167-16141189 TGTCCAAGACGATCACCCTGAGG - Exonic
1137515518 16:49140193-49140215 TTCTTAATACCATCACCTTGGGG + Intergenic
1139528716 16:67531171-67531193 TATACGATACCATCAGCCAGTGG + Intronic
1144492972 17:15730929-15730951 TATTGGGTTCCATCACCCTGAGG - Intergenic
1144581088 17:16460026-16460048 CTCTAAATACCATCACCCTGGGG - Intronic
1144907280 17:18645724-18645746 TATTGGGTTCCATCACCCTGAGG + Intronic
1147036755 17:37687306-37687328 TTTTCCACACCATCACCCTCTGG - Exonic
1147500541 17:40959090-40959112 TAGTCAATACCATCACATTGTGG + Intronic
1148538632 17:48462000-48462022 CATCCTATACCATCACCTTGGGG + Intergenic
1150147196 17:62778921-62778943 TATTCAGCACCATGAGCCTGAGG + Intronic
1150950231 17:69795348-69795370 TTTCTAATACCATCACCTTGGGG - Intergenic
1152011309 17:77720143-77720165 CCTTCGATACCATCACACTGGGG + Intergenic
1153420243 18:4897159-4897181 GATTCAATACCATCTCCATCAGG + Intergenic
1155209513 18:23588242-23588264 TATTCAATACCATCTTCATAAGG + Intergenic
1156623895 18:38885459-38885481 TTCTCAGTATCATCACCCTGGGG + Intergenic
1157576853 18:48749357-48749379 CATTCACTACCATCATCCCGAGG - Intronic
1157786000 18:50483241-50483263 CAATTAATACCATCACCTTGGGG - Intergenic
1164876807 19:31696634-31696656 CACTCAATACTATCACACTGGGG + Intergenic
1165252376 19:34550591-34550613 TCTCCAATACAATCACACTGGGG + Intergenic
1165872835 19:38985394-38985416 CTTTTAATACCATCACACTGTGG - Intergenic
1167786295 19:51639720-51639742 CTTTTAATACCATCACCTTGAGG + Intronic
927840855 2:26442586-26442608 TATTCAAAACCATGAGACTGAGG - Intronic
933230331 2:79799785-79799807 TGATCACTACCATAACCCTGTGG - Intronic
935920319 2:108005819-108005841 TACCTAATACCATCACCTTGGGG + Intronic
936599837 2:113884922-113884944 TTCCTAATACCATCACCCTGGGG + Intergenic
937134334 2:119539977-119539999 TTCTGAATACCATCACCTTGTGG - Intergenic
937713786 2:125009193-125009215 TACCCAACACCATCACCATGGGG - Intergenic
938217858 2:129536390-129536412 GATTCAATACCATCCCCATCAGG + Intergenic
938522892 2:132091064-132091086 TAGGGAATACCATTACCCTGGGG - Intergenic
941449737 2:165645429-165645451 TATCTGATACCATCACCTTGGGG + Intronic
942251695 2:174053128-174053150 TATTTAATACTATCACAGTGGGG + Intergenic
942849355 2:180465413-180465435 TTTTTAATACCATCCCACTGGGG + Intergenic
943025719 2:182624979-182625001 TTTTTAATACCATTACACTGGGG - Intergenic
943065132 2:183077703-183077725 ATTTAAATACCATCACCTTGAGG + Intergenic
943357615 2:186876594-186876616 TATTAAATATAATCACCATGTGG + Intergenic
943737126 2:191368411-191368433 TGTTTAATACCAGCATCCTGGGG - Intronic
944036261 2:195298080-195298102 TCTGCAATACCATCACACTGGGG - Intergenic
945370391 2:209009206-209009228 ATTTTAATACCATCACCTTGAGG + Intergenic
946134406 2:217633927-217633949 TAATTAAAACCATCACCATGTGG - Intronic
1169254809 20:4088806-4088828 TATTCAATACCGGGTCCCTGTGG - Intergenic
1169603765 20:7292122-7292144 TGCTCAATAACAGCACCCTGTGG + Intergenic
1171061560 20:21968515-21968537 CATTTAATATCATCACCTTGGGG - Intergenic
1172601541 20:36187310-36187332 TGTTCATTATCATCACCCAGGGG - Intronic
1175181608 20:57152309-57152331 CTTTTAATACCATCACCTTGGGG - Intergenic
1179189990 21:39115478-39115500 CATTCAATACCTTCACAGTGAGG - Intergenic
1181865590 22:25852064-25852086 CATTCAGCACCAGCACCCTGGGG + Intronic
1183174479 22:36212765-36212787 TTTTCAACACCATGCCCCTGTGG + Intergenic
1183843547 22:40521199-40521221 TACACATTTCCATCACCCTGAGG + Intronic
1184193259 22:42909045-42909067 TATTCAGTATCATGTCCCTGTGG + Intronic
1185412958 22:50695516-50695538 TATTCTTTACCCTCACCCTGAGG + Intergenic
949406117 3:3716514-3716536 CCTCCAATACCATCACACTGGGG + Intronic
949415995 3:3814566-3814588 TTCTTAATACCATCACCTTGGGG - Intronic
949489557 3:4575456-4575478 TATTAAATATCATCACCCTCAGG + Intronic
949657199 3:6234312-6234334 TTCTTAATACCATCACCTTGGGG - Intergenic
951405454 3:22291067-22291089 TCTAAAATACCATCCCCCTGGGG + Intronic
951577799 3:24131579-24131601 CCTTCAATACCATCACACTGGGG - Intronic
951911524 3:27755261-27755283 TTCTTAATACCATCACCTTGGGG - Intergenic
952100976 3:30012406-30012428 TTTTTAATACCATCACCTTAGGG + Intergenic
952114286 3:30160427-30160449 TATTGATGACCCTCACCCTGTGG + Intergenic
952711465 3:36436375-36436397 TGTTCAAAACCATCACCCTTAGG + Intronic
955767966 3:62364853-62364875 CATTCAAAACCTTCACCCTTAGG - Intergenic
956146754 3:66198542-66198564 TATTCCCCACCATGACCCTGAGG + Intronic
957332999 3:78790516-78790538 TATTCAATACCATCACCCTGTGG + Intronic
957373039 3:79320608-79320630 TCTTTAATACCATCACATTGTGG + Intronic
957587420 3:82149863-82149885 CTCTCAATATCATCACCCTGGGG + Intergenic
961314309 3:126024101-126024123 TATTGAAAACCACTACCCTGAGG + Intronic
961360296 3:126363068-126363090 TTTCTAATACCATCACCTTGGGG - Intergenic
961927150 3:130493161-130493183 TTTCTAATACCATCACCTTGCGG - Intergenic
963283789 3:143413083-143413105 TGTTCAATAACATCACCATGAGG - Intronic
967233018 3:187358852-187358874 TACTCAATATCCTCACCATGTGG + Intergenic
971670049 4:29544858-29544880 TTCTTAATACCATCACCTTGGGG - Intergenic
971749922 4:30633657-30633679 CTTTTAATACCATCACCTTGGGG + Intergenic
974511518 4:62848231-62848253 TTTCTAATACCATCACCTTGGGG + Intergenic
974705361 4:65507980-65508002 GATTCAATATCATGACCCTTAGG + Intronic
974910161 4:68107991-68108013 TTTTCAAAAGGATCACCCTGTGG + Intronic
974926920 4:68310798-68310820 TCTTCAATTCCATGCCCCTGAGG + Exonic
976700482 4:87965179-87965201 TATTGCATACCATCTCCTTGTGG + Intergenic
977605395 4:98979328-98979350 TTCTTAATACCATCACACTGGGG + Intergenic
978640699 4:110867791-110867813 TATTACATACCAACTCCCTGGGG + Intergenic
980684275 4:136205110-136205132 CTTTAAATACCATCACACTGGGG - Intergenic
981676810 4:147351947-147351969 CCTTCTATACCATCACCTTGGGG + Intergenic
982880960 4:160714450-160714472 TACTTAATACCATCACCCTGGGG + Intergenic
985286451 4:188341074-188341096 CATTTAATACCTTCACCCAGAGG - Intergenic
986227316 5:5828135-5828157 TTTTAAACACCACCACCCTGGGG - Intergenic
986788304 5:11135991-11136013 CACTTAATACCATCACCTTGGGG - Intronic
986811895 5:11368635-11368657 TATTGAACATCAACACCCTGAGG - Intronic
986945707 5:13016601-13016623 CTATTAATACCATCACCCTGGGG + Intergenic
987817451 5:22920959-22920981 GATTAAATACCATGATCCTGGGG - Intergenic
988958466 5:36344244-36344266 CTTTTAATACCATCACACTGAGG + Intergenic
989450441 5:41580978-41581000 TACTTAATACCATCACCTAGGGG + Intergenic
989680598 5:44024162-44024184 TATACAATAACATCACCTTAAGG - Intergenic
991191154 5:63875576-63875598 TACCTAATACCATCACCTTGGGG + Intergenic
992779967 5:80118900-80118922 TCCCAAATACCATCACCCTGGGG + Intronic
996178536 5:120390056-120390078 TGTTAAATACCATCACCTTGGGG + Intergenic
996241054 5:121202508-121202530 TTTCAAATACCATCACACTGGGG - Intergenic
996494144 5:124133764-124133786 TTTCCAATACCATCACATTGGGG + Intergenic
998646383 5:144066761-144066783 TATTCAAGACCATCACTCATAGG + Intergenic
999018357 5:148134403-148134425 TGTTACATACCATCTCCCTGAGG - Intronic
999420214 5:151434644-151434666 TTCTTAATACCATCACACTGAGG - Intergenic
999816121 5:155178137-155178159 TTTTTAATATCATCACCTTGGGG - Intergenic
1000628224 5:163563633-163563655 TAATCCTTACCATCACCCTAGGG - Intergenic
1001170929 5:169418261-169418283 CATTCTACTCCATCACCCTGAGG - Intergenic
1002513682 5:179740918-179740940 GAATCAATAACATCACCCAGGGG - Intronic
1004215236 6:13696830-13696852 CATCCAATACCAGCAGCCTGTGG - Exonic
1005278011 6:24240692-24240714 CATTTAATAGCATCACGCTGTGG + Intronic
1006729974 6:36229446-36229468 TATTCAATGCCACTGCCCTGAGG + Intronic
1008797901 6:55327319-55327341 TATTCAAGACCAGCACCCTCAGG + Intergenic
1010486401 6:76419732-76419754 CTTCTAATACCATCACCCTGGGG + Intergenic
1011184268 6:84657088-84657110 TTTTGAATACCATCACATTGTGG - Intergenic
1011205425 6:84889517-84889539 TTTTCACTGCCATCACCCAGGGG - Intergenic
1013357388 6:109358253-109358275 GAAGCAATACCATAACCCTGGGG + Intergenic
1013367098 6:109444782-109444804 GATTCAATTCCTGCACCCTGTGG + Exonic
1015625140 6:135173898-135173920 TATTAAATACTATCACCCCTGGG + Intergenic
1016752969 6:147651448-147651470 CTCTTAATACCATCACCCTGGGG - Intronic
1018209062 6:161462619-161462641 TTTTTAATATGATCACCCTGGGG - Intronic
1018654843 6:166025184-166025206 CTATCAATACCATCACCTTGGGG + Intergenic
1021131470 7:16917307-16917329 CATTTGATACCATCACCCTCAGG - Intergenic
1022391437 7:29947742-29947764 TGTACCATACCATCACACTGGGG - Intronic
1023767051 7:43521561-43521583 TTCTTAATACCATCACCTTGGGG - Intronic
1024135199 7:46399718-46399740 TTTTTAATCCCATCACCTTGGGG - Intergenic
1024584160 7:50826725-50826747 TTTTCAAGACCATCACCCTTTGG + Intergenic
1024857698 7:53800897-53800919 CTCCCAATACCATCACCCTGGGG - Intergenic
1027756129 7:82214137-82214159 TCTTTAATACCATCACCTTGGGG + Intronic
1028581650 7:92415335-92415357 TATTTAAAACCATTACCCTTAGG - Intergenic
1032861126 7:135880404-135880426 TCTCCAATACCATCACTCTAGGG + Intergenic
1034511231 7:151536663-151536685 TTTCAAATACCATCACACTGAGG - Intergenic
1043062734 8:75525621-75525643 TATTCAATCTCATCACTATGAGG - Intronic
1044415577 8:91935457-91935479 TTATTAATACCATCACCTTGTGG + Intergenic
1045703024 8:104888885-104888907 TATTCATTGACTTCACCCTGGGG + Intronic
1046040525 8:108897824-108897846 CATTTAATACCATCACACTGAGG + Intergenic
1046759713 8:118008625-118008647 TATTCAATACCATTTTTCTGTGG + Intronic
1046796269 8:118376316-118376338 CGTCCAATACCATCACCTTGGGG - Intronic
1048164180 8:132047888-132047910 TTTCTAATACCATCACCTTGAGG - Intronic
1049599666 8:143501502-143501524 TATGTAAAACCAGCACCCTGTGG - Intronic
1050504392 9:6332310-6332332 CTCCCAATACCATCACCCTGTGG - Intergenic
1051023937 9:12582723-12582745 TGTTCAATACGTTCACCCTGTGG + Intergenic
1053891027 9:42693214-42693236 TAATAAATACAGTCACCCTGTGG - Intergenic
1054220672 9:62408546-62408568 TAATAAATACAGTCACCCTGTGG + Intergenic
1054230042 9:62500626-62500648 TAATAAATACAGTCACCCTGTGG - Intergenic
1058166046 9:101620368-101620390 GACCTAATACCATCACCCTGGGG + Intronic
1058261031 9:102832251-102832273 TTTCCAATATCATCACCTTGGGG - Intergenic
1061390758 9:130315940-130315962 TCTCCAATACCATCACACTGGGG + Intronic
1061721322 9:132553270-132553292 TCTCCAATGCCATCACACTGGGG + Intronic
1189207700 X:39256115-39256137 CTCTTAATACCATCACCCTGGGG + Intergenic
1191845752 X:65546651-65546673 CTTTTAATACCATCACCTTGGGG + Intergenic
1194353609 X:92854218-92854240 CTTTTAATACCATCACCTTGAGG + Intergenic
1194747313 X:97642196-97642218 TCTTCATCACCATCACCCTAGGG + Intergenic
1194869965 X:99117257-99117279 AATACTATTCCATCACCCTGTGG - Intergenic
1195274358 X:103266942-103266964 AATTTAATACCATGAACCTGTGG - Intergenic
1195696603 X:107672207-107672229 TATTCTCTACCCTCACTCTGGGG + Intergenic
1196323232 X:114368930-114368952 CTTTTAATACCATCACACTGAGG + Intergenic
1196470438 X:116018111-116018133 TTCTTAATACCATCACACTGGGG + Intergenic
1197354887 X:125426138-125426160 TATTGACTACAGTCACCCTGTGG - Intergenic
1198693942 X:139315433-139315455 TATTTAATAGCAAAACCCTGTGG - Intergenic
1199298188 X:146182848-146182870 TTCTTAATACCATCACACTGGGG - Intergenic
1199371643 X:147056694-147056716 TATTCAAAACCAGCACCATTGGG + Intergenic
1200661971 Y:5971291-5971313 CTTTTAATACCATCACCTTGAGG + Intergenic
1202113182 Y:21445780-21445802 TAGCCAATACCATCACACTATGG + Intergenic