ID: 957333209

View in Genome Browser
Species Human (GRCh38)
Location 3:78792854-78792876
Sequence CTTTGGAAGGCGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318316
Summary {0: 4, 1: 1069, 2: 27256, 3: 105944, 4: 184043}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957333204_957333209 -8 Left 957333204 3:78792839-78792861 CCTGTAATCACAGCACTTTGGAA 0: 101
1: 12932
2: 320493
3: 262019
4: 140984
Right 957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
957333202_957333209 12 Left 957333202 3:78792819-78792841 CCTAGACACAGTGGCTCATGCCT 0: 3
1: 115
2: 501
3: 1353
4: 2864
Right 957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957333209 Original CRISPR CTTTGGAAGGCGAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr