ID: 957336859

View in Genome Browser
Species Human (GRCh38)
Location 3:78841345-78841367
Sequence GGACCATTTGGGCTTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957336854_957336859 5 Left 957336854 3:78841317-78841339 CCTTAAAATTAAACAGCTTCTTA 0: 1
1: 0
2: 1
3: 36
4: 383
Right 957336859 3:78841345-78841367 GGACCATTTGGGCTTAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 105
957336851_957336859 15 Left 957336851 3:78841307-78841329 CCCCAGCAGACCTTAAAATTAAA 0: 1
1: 0
2: 1
3: 22
4: 277
Right 957336859 3:78841345-78841367 GGACCATTTGGGCTTAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 105
957336853_957336859 13 Left 957336853 3:78841309-78841331 CCAGCAGACCTTAAAATTAAACA 0: 1
1: 0
2: 1
3: 6
4: 233
Right 957336859 3:78841345-78841367 GGACCATTTGGGCTTAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 105
957336852_957336859 14 Left 957336852 3:78841308-78841330 CCCAGCAGACCTTAAAATTAAAC 0: 1
1: 1
2: 0
3: 14
4: 169
Right 957336859 3:78841345-78841367 GGACCATTTGGGCTTAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957336859 Original CRISPR GGACCATTTGGGCTTAAAGG AGG Intronic
900055900 1:630412-630434 GGCCCATTTGGGCAAAAAGCCGG - Intergenic
900762373 1:4481888-4481910 TCACCCTGTGGGCTTAAAGGTGG - Intergenic
905997687 1:42395788-42395810 GGACAATTTGGGTTTAAGGCTGG - Intronic
907505695 1:54916532-54916554 GGACCACTTGGGGTGAAGGGGGG + Intergenic
908561032 1:65306765-65306787 TGAGAATTTGGGCTTAAGGGAGG - Intronic
909182368 1:72440230-72440252 GGACCACCTGGGGTTAGAGGAGG + Intergenic
909607183 1:77519349-77519371 GGACCATTCTGGCTTCCAGGTGG - Intronic
910590935 1:88927577-88927599 GGACCATTTGGGTTGAAGGGGGG - Intergenic
910702309 1:90089519-90089541 GTACCATTTGGGCATATTGGAGG + Intergenic
918521828 1:185423390-185423412 GGTCCATTTTGCCTGAAAGGAGG + Intergenic
921549149 1:216511833-216511855 GGACAATTTGGGCTTCAAAAAGG + Intronic
922684790 1:227630754-227630776 GGACCATTTGGGTTGAAGGGGGG + Intronic
1062969404 10:1634437-1634459 GGACCATCTGAGCTGAGAGGAGG + Intronic
1063193108 10:3716731-3716753 GGTGAATTTGGGCTCAAAGGAGG - Intergenic
1065762368 10:28994236-28994258 GGACCAGTGGGGCTTCATGGAGG + Intergenic
1069030604 10:63592200-63592222 GCATCCTTTGGGCTTCAAGGTGG + Intronic
1071438735 10:85670681-85670703 GGACCCTGTGGGCTGAAGGGTGG - Intronic
1074560201 10:114528915-114528937 AGACCATTTGGGGTTAAGGATGG + Intronic
1076544562 10:131236665-131236687 GGACCAGCTGGGCTCCAAGGAGG - Intronic
1076874230 10:133208082-133208104 GGACCCTTGGGGCTCCAAGGTGG - Intronic
1080408286 11:31999647-31999669 GGACTATGTTGGCTTAAATGTGG + Intronic
1081275313 11:41141212-41141234 GGAGCATTGGGGCTGAAAGAAGG - Intronic
1081491103 11:43569637-43569659 GGACCATTTTGGCTTTACTGGGG - Intronic
1085409358 11:76282213-76282235 GGCCCATTTGGGCACAAGGGTGG + Intergenic
1086876510 11:92103063-92103085 GGATCATTGGTGCTGAAAGGTGG - Intergenic
1091940603 12:4477238-4477260 GAACCATTTGTGGTTAAGGGTGG - Intergenic
1092285084 12:7124041-7124063 GCACAATCTGGGCTTGAAGGGGG + Exonic
1093706801 12:22283425-22283447 GGACCATGCAGGCTTAAAAGGGG + Intronic
1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG + Intronic
1097841350 12:64324717-64324739 GTATCATTTTGGCTTTAAGGTGG + Intronic
1098283867 12:68888658-68888680 GGAACTTTTGGGAATAAAGGTGG - Intronic
1105728355 13:23187280-23187302 GGACCTATTGGGCATCAAGGAGG - Intronic
1107430890 13:40339167-40339189 GGACATTTTGGGAGTAAAGGGGG - Intergenic
1109853437 13:68099259-68099281 GGAACATTTGTGTTTAAAGAGGG - Intergenic
1114384223 14:22239386-22239408 GGACCATTTGGGTTGAAGGGGGG - Intergenic
1126474113 15:49047821-49047843 GGAACATTTGGGATTCAAGAGGG - Intergenic
1133361751 16:5179564-5179586 AGACAATTTGGGCATAAGGGTGG - Intergenic
1134016159 16:10889942-10889964 TGCCCATTTGAGCTTAGAGGAGG - Intronic
1149274186 17:55015707-55015729 GTACCGTTTGGGTTGAAAGGGGG + Intronic
1149935193 17:60797952-60797974 GGATCATTTGAGCTGGAAGGTGG + Intronic
1152169605 17:78735627-78735649 GGATCATTTGCACTTAGAGGTGG + Intronic
1155732048 18:29172811-29172833 GAACCATGTGGACTTAAAAGTGG - Intergenic
1156108564 18:33695422-33695444 TCACCATTTGGGCTTTATGGTGG + Intronic
1158712235 18:59847959-59847981 GGACCATTTGGGTTCCAAGATGG + Intergenic
1158900087 18:61954397-61954419 GTACCATGAGGGCTTACAGGAGG + Intergenic
926864370 2:17341934-17341956 GGACCATTTGGGTAAAAGGGGGG - Intergenic
928600023 2:32895409-32895431 TGACCATTTGAGCTTGAAAGAGG + Intergenic
929056120 2:37877723-37877745 TGAACATTAGGGCTTAAAGAGGG + Intergenic
932917572 2:75874748-75874770 GGACCATTTGGGTAAAAGGGGGG - Intergenic
933175357 2:79167468-79167490 GGACTATTTGGGTTGAAGGGGGG + Intergenic
933994354 2:87656837-87656859 GGAGCATGTGGGCTGAGAGGAGG - Intergenic
935543718 2:104378589-104378611 GCAACATTTGGGCTGAAAGCAGG + Intergenic
936299506 2:111294076-111294098 GGAGCATGTGGGCTGAGAGGAGG + Intergenic
937946428 2:127342212-127342234 GGAGAATTTGGGCTACAAGGGGG + Intronic
941809642 2:169742758-169742780 GGTCCATTTGGGCTACTAGGAGG - Intronic
944483808 2:200182471-200182493 GGCCCTTTTGGGCCTGAAGGTGG - Intergenic
944761272 2:202817169-202817191 GGACCATTTGAGGTTGAAGAGGG - Intronic
946047498 2:216833411-216833433 GGACCTGTTGGTCTCAAAGGAGG - Intergenic
1169532753 20:6503269-6503291 GGAAAAGTTGGGCTTCAAGGAGG - Intergenic
1173209004 20:41017305-41017327 TGAGCATTTGGGTTCAAAGGGGG - Intergenic
1179259224 21:39743583-39743605 GGACCATTTGGGCTGAAGAGGGG + Intergenic
1182004516 22:26948652-26948674 AGACATTTTGGGCTTGAAGGGGG + Intergenic
1183956582 22:41383825-41383847 GGGTCATTTGGGATCAAAGGAGG - Intronic
1184475875 22:44720960-44720982 GGGCCATTTGGTCCTGAAGGAGG + Intronic
951200779 3:19873736-19873758 GGACCGTTTGGGTTGAAGGGGGG + Intergenic
952922323 3:38294166-38294188 GGACCGTTTGGGTTGAAGGGGGG + Intronic
954984380 3:54776746-54776768 GGTCCACTGGGGCTTAAAGGAGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957336859 3:78841345-78841367 GGACCATTTGGGCTTAAAGGAGG + Intronic
958016350 3:87943538-87943560 GGACCATTTGGGTTGAAGGGGGG + Intergenic
958629895 3:96671580-96671602 GGACCGTTTGGGTTGAAGGGGGG + Intergenic
961144550 3:124583389-124583411 GGTCCAAGTGGGCTTCAAGGGGG + Intronic
963187852 3:142438940-142438962 GGACCGTTTGGGTTAAAGGGGGG - Intronic
964675349 3:159272302-159272324 GATCCATTTGGCCTTAAGGGAGG + Intronic
966353403 3:179055509-179055531 GGACCGTTTGGGTTAAAGGGGGG - Intronic
970602951 4:17654703-17654725 GGCCAACTTGGGCTCAAAGGTGG - Intronic
978586901 4:110283514-110283536 GGACCATTTGGGTTGAAGGGGGG + Intergenic
979298035 4:119054806-119054828 AGACTATTTTGGCTTGAAGGTGG + Intronic
984179703 4:176467071-176467093 GGAGCATTTGTTATTAAAGGAGG - Intergenic
984723656 4:183000072-183000094 GGACCGTTTGGGTTGAAGGGGGG - Intergenic
988957268 5:36332174-36332196 GGACCGTTTGGGTTGAAGGGGGG + Intergenic
991313412 5:65271570-65271592 TGATCATTTGTGCTTAAAGCAGG - Intronic
997951248 5:138244221-138244243 GGATCATTTAGGCTTCATGGAGG - Intergenic
999878401 5:155834185-155834207 GGAGTATTTAGTCTTAAAGGAGG - Intergenic
1002107990 5:176889613-176889635 GGACCATTTGTGATGACAGGTGG - Intronic
1009544686 6:65007658-65007680 GGACCGTTTGGGTTGAAGGGGGG - Intronic
1010893408 6:81340050-81340072 AGACCATTTGGGTTGAAGGGGGG - Intergenic
1011189872 6:84717549-84717571 GGACCATTTGGGTTGAAGGGGGG + Intronic
1013022146 6:106231028-106231050 GGACCGTTTGGGTTGAAGGGGGG - Intronic
1013543456 6:111133744-111133766 GGACTGTTTGGGTTGAAAGGGGG - Intronic
1015795752 6:137009481-137009503 GGCCAATTTGTGCTTAAAGGGGG + Exonic
1016167044 6:140959212-140959234 GTCCCATTTGGCCTTAAAGATGG + Intergenic
1016444807 6:144120637-144120659 GGACCGTTTGGGTTGAAGGGGGG + Intergenic
1016627156 6:146184945-146184967 GTACCATGTGTGCTGAAAGGTGG + Intronic
1018760950 6:166893953-166893975 GGACCGTTTGGGTTCAAGGGGGG - Intronic
1028588678 7:92474950-92474972 GGACCATTTGGGTTGAAGGGGGG + Intronic
1030843583 7:114383398-114383420 GGACCGTTTGGGTTGAAGGGGGG + Intronic
1032610506 7:133407727-133407749 GGACCATTTCTCCTTGAAGGAGG + Intronic
1035546715 8:487245-487267 TGAGCATCTGGGCTTAAGGGAGG + Intergenic
1035872194 8:3147846-3147868 GCACCATTTGCACTTACAGGAGG + Intronic
1037518345 8:19655934-19655956 GGACCATTTGGGGTTAGAATTGG + Intronic
1037739741 8:21598752-21598774 AGACCTTTTGGGCTTTAAGCAGG + Intergenic
1038285634 8:26204022-26204044 GGACCATTTGGGGTGAAGGTAGG + Intergenic
1039069652 8:33637874-33637896 GTAGAATCTGGGCTTAAAGGAGG + Intergenic
1040933177 8:52756469-52756491 GGTGCATGTGGGCATAAAGGTGG - Intergenic
1041663966 8:60424592-60424614 GGATCATTTGGGTTGAAGGGGGG + Intergenic
1042528599 8:69792311-69792333 GTAAAATTTGGGCATAAAGGGGG + Intronic
1046304294 8:112343397-112343419 GGATCATTTTGGCTAAAATGTGG - Intronic
1047443972 8:124903241-124903263 GTACCATTTGGGTTGAAGGGGGG + Intergenic
1057229856 9:93314628-93314650 GGACCATTAGGTCTTTAGGGAGG - Intronic
1061095977 9:128456869-128456891 GGACCAATAGTGTTTAAAGGAGG - Intronic
1062316629 9:135970531-135970553 GGACCCTTTGGGGTTTCAGGAGG - Intergenic
1202629548 M:5242-5264 GGCCCATTTGGGCAAAAAGCCGG - Intergenic
1187980354 X:24749942-24749964 AGACTATTTAGCCTTAAAGGAGG + Intronic
1192790117 X:74373280-74373302 GGATATTTTGGGCTTCAAGGTGG + Intergenic
1199520986 X:148735396-148735418 GGAACACTTGGGCTAAAATGTGG + Intronic
1199765414 X:150937668-150937690 GGACCATTTGTGATTACAGGGGG + Intergenic
1200152381 X:153957522-153957544 GGGCCCTTTGGTCTGAAAGGGGG + Exonic