ID: 957337191

View in Genome Browser
Species Human (GRCh38)
Location 3:78846427-78846449
Sequence CACAGGGAAATGTCTAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957337191 Original CRISPR CACAGGGAAATGTCTAAGAG TGG (reversed) Intronic
903023799 1:20412754-20412776 CACAAGAAAATGTCAAAAAGTGG + Intergenic
905774874 1:40662013-40662035 CACAGGGAAAAGGGTAGGAGAGG + Intronic
905820979 1:40990807-40990829 CACAGGAAAGTGTCTAATGGGGG + Intronic
906125141 1:43422954-43422976 CACAGGGCCAGGTCTAATAGAGG + Intronic
907904007 1:58767677-58767699 GACTGGGAAATGTGGAAGAGTGG - Intergenic
909440471 1:75690450-75690472 CAGATGGAAATCTCTGAGAGGGG + Intergenic
910297272 1:85661889-85661911 CAAGAGGAAATGTCTAAGAAGGG - Intronic
912589661 1:110803652-110803674 CAAAGGGAAAGGACTAAGAGAGG + Intergenic
913215941 1:116620479-116620501 CATAGGGCAAGGTCTGAGAGGGG - Intronic
913471820 1:119195871-119195893 CAAAGGGAAATGTGACAGAGGGG + Intergenic
915737222 1:158092729-158092751 CACAGGGAAAGATCTCAGAGGGG + Intronic
916001796 1:160623619-160623641 CATAGGGAAATTTGGAAGAGAGG + Intronic
916972674 1:170041540-170041562 CACAGGCAGATGCCTACGAGGGG - Intronic
921220030 1:212967046-212967068 GCCAGGGAAAATTCTAAGAGTGG + Intronic
921536124 1:216350824-216350846 CACAAGGCAATGTCCTAGAGGGG + Intronic
921945949 1:220886247-220886269 TCCAGGGGAATGTCTAAAAGTGG - Intergenic
922010736 1:221583279-221583301 CTTAGGTAAATATCTAAGAGTGG - Intergenic
922115860 1:222613798-222613820 CACAGGGCAAAGTCCAAGAGAGG - Intergenic
923360003 1:233201711-233201733 CACAGGGAAAAGTCTAGGTATGG + Intronic
1064594683 10:16931561-16931583 TAGATGGAAATTTCTAAGAGAGG - Intronic
1066187178 10:33021492-33021514 TACAGGGAAATCTCAAAAAGAGG + Intergenic
1069640225 10:69950184-69950206 CATAAGTAAATGTCTAACAGTGG - Intronic
1069838885 10:71326981-71327003 CACAGGGAAATCAGGAAGAGAGG - Intronic
1071400076 10:85260342-85260364 AAGAGGGAAATGCCAAAGAGTGG + Intergenic
1071964551 10:90838840-90838862 AATAGGGCAATGTGTAAGAGTGG - Intronic
1072835688 10:98709519-98709541 CACACAGAAAAGTGTAAGAGAGG + Intronic
1074432756 10:113407695-113407717 TACAGGCAAATGAATAAGAGGGG - Intergenic
1075458113 10:122598106-122598128 CACAGGGACATGAAAAAGAGAGG - Intronic
1076605281 10:131685416-131685438 CAAAGGGAAAGGGCTCAGAGAGG + Intergenic
1078008638 11:7552237-7552259 CACAGGCAACTCTCTAAGATGGG - Intronic
1080131390 11:28799245-28799267 CACAGAAAAATCTTTAAGAGAGG + Intergenic
1080317213 11:30963832-30963854 CACAGGAAAATGTAAAAGACTGG - Intronic
1080337025 11:31209344-31209366 CACAAGGAATAGTCTGAGAGGGG + Intronic
1082933340 11:58631635-58631657 CAGAAGGAAATATCAAAGAGGGG + Intergenic
1083040683 11:59682420-59682442 CAAAGGTAAATGTCAAAGACAGG + Intergenic
1085060629 11:73443136-73443158 CACTGGGAAAGGGCTAAGAAAGG - Intronic
1087170558 11:95045586-95045608 CACAGGGAAATGTCGATCTGTGG - Intergenic
1087294756 11:96358118-96358140 CATAGGGAAATTTGTAAAAGAGG - Intronic
1087404038 11:97706833-97706855 CACAGGAAAATGTGTAAATGTGG - Intergenic
1088401005 11:109422656-109422678 CACAGGGAAATGGGGAGGAGGGG + Intronic
1089071446 11:115702479-115702501 CTAAGAGCAATGTCTAAGAGTGG - Intergenic
1089391368 11:118104280-118104302 CCTGGGGAAATGTCTGAGAGAGG - Intronic
1093839942 12:23885166-23885188 CAGAGGGAAAGGTCTAGTAGTGG + Intronic
1093969379 12:25360940-25360962 CACAGGGAAAGATCAAGGAGAGG + Intergenic
1094138025 12:27150226-27150248 CAGAGGGAAAGGAATAAGAGTGG - Intergenic
1094597551 12:31878982-31879004 CCCAGGGAACAGTCTAAAAGAGG + Intergenic
1095119507 12:38399969-38399991 CTCTGTGAAATGTCTAAGAAAGG + Intergenic
1095840163 12:46684049-46684071 CATAGAGAAATGTCTAAGGTGGG - Intergenic
1097806500 12:63970131-63970153 CACAGGGAAATTTAACAGAGAGG + Intronic
1098233183 12:68393525-68393547 CACAGGGAATGGTGTGAGAGAGG - Intergenic
1099058286 12:77872613-77872635 ATCAAGGAAATGTCTAAGAGAGG + Intronic
1099729220 12:86476926-86476948 CACAGGGAAATGATGAAGCGGGG + Intronic
1105219676 13:18313958-18313980 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
1107352908 13:39534662-39534684 CTCAAGAAAATGGCTAAGAGTGG + Intronic
1108164617 13:47679046-47679068 AAGAGGGAAGTGTCTAAGAGAGG + Intergenic
1108587775 13:51885742-51885764 CAAAGGGAAGTGCCTAGGAGGGG - Intergenic
1111788460 13:92821497-92821519 CACTGGGCAATGTCTATCAGAGG + Intronic
1112180728 13:97077287-97077309 CCCAGGGAATTGTTGAAGAGCGG - Intergenic
1112232045 13:97598754-97598776 CATAGGTAAATATCTAACAGTGG - Intergenic
1112588477 13:100741335-100741357 CACAGCAAAATTTCTAAGAAAGG - Intergenic
1112892375 13:104253930-104253952 CACTATGAAATGTCTAAGTGTGG + Intergenic
1112992451 13:105530547-105530569 CTTAGGGAAATGTTTAACAGTGG - Intergenic
1113540074 13:111100449-111100471 CACAGGGACCTGTGTAAGATTGG + Intergenic
1117591252 14:57270242-57270264 CACAGGGCAAATTCTAATAGTGG - Intronic
1117651106 14:57906296-57906318 CATAGAGAAATGTATAAGACTGG + Intronic
1121176606 14:91895282-91895304 CAAAGGGAAATGGCCAAGAAGGG + Intronic
1122325619 14:100879437-100879459 CACAGGCTCATGTCAAAGAGAGG - Intergenic
1122376135 14:101259787-101259809 CTCAGGCAAATACCTAAGAGTGG + Intergenic
1127517917 15:59714201-59714223 CAGAGTGAAATGACTAAGGGAGG - Intergenic
1128309536 15:66621811-66621833 GACAAGGAAATCTCTAAGACTGG - Intronic
1128921240 15:71612082-71612104 TCCAGAGAAATGGCTAAGAGGGG - Intronic
1130248541 15:82277890-82277912 CATAGGGAAGAGTCTATGAGTGG - Intronic
1130318826 15:82822340-82822362 CACAGTGAAATGAATAATAGTGG + Intronic
1130451521 15:84058273-84058295 CATAGGGAAGAGTCTATGAGTGG + Intergenic
1130684151 15:86022355-86022377 GCCAGGGAAATGTCTCATAGGGG + Intergenic
1131801743 15:96076344-96076366 AAAAGGGAAATGTCGAGGAGCGG + Intergenic
1131905546 15:97138048-97138070 CACTAGGTAATATCTAAGAGTGG - Intergenic
1132085269 15:98903463-98903485 CCCAGGGAAATGTGAAAAAGCGG - Intronic
1133056961 16:3150181-3150203 CACAGGGACATGTCTGGGAGAGG - Intergenic
1135175211 16:20221746-20221768 CAGAGGGAAATGACAGAGAGAGG - Intergenic
1137032711 16:35538992-35539014 GACAGGGAAATGGCTAAAATAGG + Intergenic
1137576925 16:49606213-49606235 CACAGGAGAGCGTCTAAGAGAGG - Intronic
1138209365 16:55150381-55150403 CAGAGGGAAATGACTATCAGTGG - Intergenic
1140328221 16:74026813-74026835 CACAGAGAAATGACAAAGAGAGG + Intergenic
1140489255 16:75320496-75320518 CACAGGGAAAAATCAAAGAATGG - Intronic
1140679134 16:77367111-77367133 CAGAGGTAAATGTCTAGGTGTGG - Intronic
1141191426 16:81827632-81827654 CACTGGGAAAGTTCTAAGGGTGG + Intronic
1141224685 16:82103911-82103933 CACAGGGCAATGCTAAAGAGAGG - Intergenic
1141962261 16:87417121-87417143 CGCCGAGAAATGTCTAAAAGGGG + Intronic
1142691087 17:1606413-1606435 CACAGAGAAATGTCTCATCGGGG + Intronic
1144208034 17:12993064-12993086 GACAAGGACATGTCTCAGAGGGG + Intronic
1146583050 17:34056949-34056971 CTGGGGGAAATGTCAAAGAGTGG + Intronic
1148560426 17:48602786-48602808 CACAGCGAACTGTCTAAGGGAGG + Intronic
1149827110 17:59838891-59838913 CAAAGGGAAATGACTAGAAGAGG + Intronic
1152995034 18:398618-398640 CACAGGGAAATCTCACAGATGGG + Intronic
1154131347 18:11739262-11739284 CACAGGGAAATGTGAACAAGAGG - Intronic
1155898996 18:31364407-31364429 TACAGGGAAATGTTCAAGAAAGG - Intergenic
1156247744 18:35318408-35318430 CACAGGGAAATGAAGTAGAGAGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161542364 19:4859774-4859796 CCCAGGGAAATGACCAGGAGGGG + Intronic
1162327335 19:10006963-10006985 CAGAGGGCAAAGTCTGAGAGAGG - Intronic
1162958546 19:14113129-14113151 CACAGGGCAAGGTTTGAGAGAGG - Intronic
1164796287 19:31034905-31034927 CACAGTGATATATCTAGGAGGGG + Intergenic
926436892 2:12847345-12847367 GACTGGGAAACGTCTAAGAATGG + Intergenic
926641921 2:15246216-15246238 CACAGGCAAAGGCCTAAGAAAGG - Intronic
926772358 2:16389707-16389729 CTCAGGGGCATGTCTAAGTGCGG - Intergenic
927268159 2:21176351-21176373 CCAAGGGAAATGTGTTAGAGGGG + Intergenic
928766170 2:34648602-34648624 CAAAGAGAAATGATTAAGAGTGG - Intergenic
930399693 2:50867393-50867415 TACAGGGAAATGGTTGAGAGGGG + Intronic
931117177 2:59177528-59177550 TGCAGGGAAATATCTAAGATTGG - Intergenic
932548991 2:72747371-72747393 CACAGGACAATGTCTAAGGCAGG - Intronic
932629251 2:73324199-73324221 CAAATGAAAATATCTAAGAGAGG + Intergenic
933700445 2:85251661-85251683 CACAGGGAACTATCAAAAAGCGG - Intronic
934184372 2:89658561-89658583 CATAGGGCAAGGTCTGAGAGGGG + Intergenic
934294657 2:91732699-91732721 CATAGGGCAAAGTCTGAGAGGGG + Intergenic
934575301 2:95396823-95396845 CACAGGGAAATGGCCCAGAGAGG + Intergenic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
936475414 2:112835500-112835522 CACAGGGAAAGCTCAAAGAAGGG - Intronic
939671425 2:145017376-145017398 CACAAGGAAATTTCTCAAAGAGG - Intergenic
939703439 2:145421845-145421867 CACAGCTAAATGTCTAGGAGAGG + Intergenic
943779961 2:191812624-191812646 CACAGTGAAATGTGGGAGAGTGG + Intergenic
944554246 2:200872279-200872301 CATAGGGCAAAGTCTGAGAGAGG + Intronic
944647251 2:201792214-201792236 TACAGGGATATGCCTTAGAGGGG + Intronic
945325291 2:208474809-208474831 GAGACGCAAATGTCTAAGAGAGG + Intronic
947708738 2:232297159-232297181 CATAGAGAAATGCCTTAGAGGGG - Intronic
947849825 2:233276845-233276867 CACAGGGAAATTTCTAATACTGG - Intronic
948981037 2:241494903-241494925 CACAGGGAAGTTTCGAAGGGGGG + Exonic
1168963152 20:1882339-1882361 CCCAGGGAAATATCTAGAAGGGG + Intergenic
1169958824 20:11135828-11135850 GCCAGGGAAATGTCTAAGGAGGG - Intergenic
1173275148 20:41573947-41573969 CACAGGGAAAAGGGCAAGAGTGG + Intronic
1176056067 20:63149965-63149987 GAGAGGGAAGTGTGTAAGAGGGG + Intergenic
1177651720 21:23967354-23967376 CACCTGGAAATGTCCAAAAGAGG - Intergenic
1177943610 21:27440867-27440889 CCCAAGGTAATGTCTACGAGTGG - Intergenic
1180753222 22:18140700-18140722 CACAGGGTAGGGTCAAAGAGTGG - Intronic
1180817277 22:18798846-18798868 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
1181203467 22:21233167-21233189 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
1183778562 22:39983884-39983906 AACAGGGCAATGTCTGAGTGTGG + Intergenic
1203223454 22_KI270731v1_random:62247-62269 CATAGGGCAAGGTCTGAGAGGGG + Intergenic
1203267376 22_KI270734v1_random:24573-24595 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
949113307 3:288739-288761 CACAGGGAATTGTCTGTGAAGGG + Intronic
949350747 3:3122739-3122761 CTCAGGTAAATATCTAGGAGTGG + Intronic
950162848 3:10772832-10772854 CCCAGGGGAATGTCGAAGAAAGG + Intergenic
951630668 3:24716618-24716640 CCCAGGGAAAGGACTCAGAGAGG + Intergenic
954962704 3:54580362-54580384 CGCAGGGACAGGTCGAAGAGGGG - Intronic
955580283 3:60412465-60412487 GAGAGGGAAATGCGTAAGAGAGG - Intronic
955729569 3:61970373-61970395 CACAGGGAAACATCTAAGGAGGG + Intronic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
957505614 3:81116576-81116598 CACAGAGAAATCCCTAATAGAGG - Intergenic
958031456 3:88115985-88116007 AACAGGGAAATGTGTGAGAGAGG + Intronic
958198623 3:90278340-90278362 CACAAAGAAGTTTCTAAGAGAGG + Intergenic
958993155 3:100871038-100871060 AACAGGGAAATGTAGAACAGAGG + Intronic
959663857 3:108899983-108900005 CACAGGAAAATGTTCATGAGTGG - Intergenic
961198778 3:125027204-125027226 CATGAGGAAAGGTCTAAGAGAGG + Exonic
964285320 3:155111388-155111410 CAAAGGGAAATTTTAAAGAGTGG + Intronic
964710611 3:159667680-159667702 CACAGGGAAATGTCTTTTATGGG + Intronic
965168968 3:165235903-165235925 CTCAGGCAAATATCTAAGAGAGG + Intergenic
965972618 3:174580835-174580857 CTCAGGGAGATACCTAAGAGTGG + Intronic
967234780 3:187373570-187373592 CTCAGGGAAATCCTTAAGAGAGG + Intergenic
969160987 4:5258766-5258788 CACTGGGAATTGACTAACAGGGG - Intronic
969392489 4:6900948-6900970 GACAGGCAAATGTCTAGGAGAGG + Intergenic
970278997 4:14433428-14433450 TAAGGGGACATGTCTAAGAGGGG - Intergenic
971496864 4:27275754-27275776 CCCAGGGATGTGTCTTAGAGTGG + Intergenic
973310414 4:48703772-48703794 CTCAGGGAATGGTCTAAGAGGGG - Intronic
974042856 4:56872393-56872415 TACAGGGAAATGACCAACAGTGG - Intergenic
975286402 4:72626424-72626446 CTCAGGAAAATATCTGAGAGTGG - Intergenic
975573642 4:75841998-75842020 CACAGGGAAATGTTTGAAATAGG + Intergenic
977750512 4:100604366-100604388 GACAAGCAAATGTCTAAGAGGGG - Intronic
978631353 4:110749701-110749723 CACAGGGAAAGGTTTAAGAAAGG - Intergenic
979879956 4:125942744-125942766 CACAGTGAAATGGCCAAGATTGG + Intergenic
980539572 4:134176801-134176823 CACAGGGACCTGTGTAAGACTGG + Intergenic
981241717 4:142484768-142484790 CACAGGGACCTGTCGAAGGGTGG - Intronic
983689257 4:170448293-170448315 CACAGAGAAATGGCTACGTGAGG - Intergenic
983861004 4:172707039-172707061 CACAGGTAAAAGTGTAATAGAGG - Intronic
985182534 4:187280603-187280625 CAGAGAGAGATGTGTAAGAGGGG + Intergenic
990780110 5:59351194-59351216 TACATGGAAATGGCTCAGAGAGG + Intronic
990982505 5:61614790-61614812 CTCAGGGGAATTTCTAATAGTGG + Intergenic
991314080 5:65279806-65279828 GATAGGGAAATATCTAAGAGAGG - Intronic
993413560 5:87600215-87600237 CACAGGGGAATGTGTTAGCGAGG + Intergenic
993476543 5:88373315-88373337 CACAGGGGAATGTTTTAAAGTGG + Intergenic
993627897 5:90247903-90247925 CAAATGGAATTGTCTAAGAATGG - Intergenic
995390166 5:111632091-111632113 CAGAGGAAAATGGCTAAGTGAGG - Intergenic
996599569 5:125245856-125245878 CACAGGGACATGTGCAAGACTGG - Intergenic
996767630 5:127050198-127050220 GACAGGGAATTATCCAAGAGTGG + Intronic
997609315 5:135202878-135202900 CACACGGAATTGGGTAAGAGTGG - Intronic
999115412 5:149159014-149159036 CACAGGGAAATATCTAGGAGAGG - Intronic
999523733 5:152380228-152380250 CAGAGAGAACTGTCCAAGAGAGG + Intergenic
999791489 5:154944048-154944070 CACAGTTAAATGTCAAAGTGAGG + Intronic
1001216185 5:169858296-169858318 GCCAGGCAAATGTCTAAGAGGGG + Intronic
1006951103 6:37821296-37821318 CACAGGGAAATTTTTGAGAAAGG - Intronic
1007530926 6:42541551-42541573 CACAGGGAAAAGAATGAGAGAGG + Intergenic
1008331388 6:50248612-50248634 GACAGTGAAATATCTAATAGTGG - Intergenic
1008542667 6:52558787-52558809 CACATGGAAAAGCCTAATAGAGG - Intronic
1009623408 6:66104751-66104773 CACAGGGAAGAGTATCAGAGAGG + Intergenic
1010377420 6:75187372-75187394 CACAGGGAAAGTTCCAACAGTGG + Intronic
1011103282 6:83748367-83748389 CAGAGGGAAAGGTGGAAGAGGGG + Intergenic
1012826610 6:104153910-104153932 GAAAGGGAAAGGGCTAAGAGAGG - Intergenic
1013813048 6:114066082-114066104 CACAATGAAATGTCTAACTGTGG - Intronic
1013867489 6:114716252-114716274 CAGTGAGAAATGTCTAGGAGTGG + Intergenic
1014272057 6:119347518-119347540 CACAGGGAAGTAGCTCAGAGAGG + Intronic
1015455543 6:133423187-133423209 AACAGGGAAAAATCTAGGAGGGG + Intronic
1016581623 6:145634498-145634520 CAGAGGGGAATGGGTAAGAGAGG - Intronic
1018390567 6:163338009-163338031 CTCAGGGAGATGCCCAAGAGGGG - Intergenic
1020802253 7:12746365-12746387 CACAGGAAAGTGACTAATAGGGG + Intergenic
1021171609 7:17404424-17404446 AACAGGCAAACTTCTAAGAGGGG + Intergenic
1021951867 7:25782933-25782955 CACATGGAAATGACTATGAATGG + Intergenic
1022131629 7:27410039-27410061 CACAGGGAAAGGGAGAAGAGAGG - Intergenic
1022702104 7:32771236-32771258 CACATGGTACTTTCTAAGAGAGG + Intergenic
1022921717 7:35022942-35022964 GACAGGGAAATCTCTCCGAGGGG - Intronic
1023217656 7:37882154-37882176 CACAGGCAAATTTCTAAGTAAGG - Intronic
1024638964 7:51315131-51315153 AACAGGGAAATGTGAAACAGAGG - Intronic
1025997144 7:66535092-66535114 CAAAGGGAACTGTCTTAAAGTGG - Intergenic
1028326584 7:89534332-89534354 TACAGGGAAATGCTTAAAAGTGG + Intergenic
1028745858 7:94326028-94326050 CACAGGTATATTTCTTAGAGTGG + Intergenic
1029811590 7:103054491-103054513 CAAAGATAAATGTTTAAGAGAGG - Intronic
1031829602 7:126610102-126610124 CACAGTGACAGGTCTAACAGTGG + Intronic
1033551078 7:142448762-142448784 CACAGGTAAATATTCAAGAGAGG + Intergenic
1033881513 7:145889606-145889628 CACATGGAAATGTCTCAGATAGG + Intergenic
1033890759 7:146010399-146010421 TACTGAGAAATGTCCAAGAGAGG - Intergenic
1034212393 7:149375402-149375424 CAGAGCCAAATGTCTAGGAGAGG - Intergenic
1034456114 7:151171490-151171512 CAGATGGAGATGTCAAAGAGGGG - Intronic
1035918970 8:3656207-3656229 CACATGGTTATGTCTAACAGCGG - Intronic
1036244378 8:7103883-7103905 GACAGGGAAATGTGCAAGGGTGG + Intergenic
1036779684 8:11637234-11637256 CAGAGGGAGATGTCTAGGACAGG + Intergenic
1036897453 8:12647526-12647548 GACAGGGAAATGTGCAAGGGTGG - Intergenic
1037332383 8:17756241-17756263 CCCAGGGACTTGTCAAAGAGAGG + Intronic
1039985103 8:42440619-42440641 TCCAGGGAAATATCTAGGAGTGG + Intronic
1041519707 8:58741575-58741597 CTCAGGGAAATGTCTGAAACAGG - Intergenic
1041751059 8:61261420-61261442 CAAATGGCAATGTCTAACAGGGG - Intronic
1042587979 8:70363434-70363456 CATAGGTAAATATCTAGGAGTGG - Intronic
1043189420 8:77199559-77199581 CACTTGGAAATGTGTAAAAGTGG + Intergenic
1043774177 8:84243894-84243916 CAAAGGGAAATGCCAAAGAGAGG - Intronic
1044502709 8:92978138-92978160 CACAGGGAAAGGTGTCAGACAGG - Intronic
1045953503 8:107879132-107879154 CACAGGGAAAGGTTTGTGAGAGG + Intergenic
1048032250 8:130643583-130643605 CACATAGAAGTGTCTAAGTGGGG + Intergenic
1049192176 8:141294563-141294585 CACAGGGAACTGGCTGTGAGGGG - Intronic
1051204532 9:14670896-14670918 GAAAGGGAAATGACTAAGAAAGG - Intronic
1051430921 9:16979639-16979661 CACAGTTAAATTTATAAGAGGGG + Intergenic
1052435676 9:28425429-28425451 AAAAGGAAGATGTCTAAGAGAGG + Intronic
1055407990 9:75994823-75994845 CAAAGGGAAATGACTAAATGGGG - Intronic
1056034502 9:82589405-82589427 CAAAAGGAAAGGTCTAAGACTGG - Intergenic
1057705369 9:97391765-97391787 CTCAGGGAAAGGTCCCAGAGGGG + Intergenic
1058422567 9:104846513-104846535 CACAAGAAAATGTCTAGAAGTGG + Intronic
1058727837 9:107820293-107820315 CACAATGAAATGTGTATGAGTGG - Intergenic
1061599534 9:131658311-131658333 CACATGGCCATGTCTAAGAAAGG + Intronic
1061991299 9:134160172-134160194 CACAGGTATATACCTAAGAGTGG - Intergenic
1192016873 X:67340710-67340732 AAAAGGTAAAAGTCTAAGAGAGG - Intergenic
1193638237 X:83979636-83979658 CTCAGGGGAATGTGTAAGAGAGG + Intergenic
1193990255 X:88298529-88298551 CATAGGAATATTTCTAAGAGTGG + Intergenic
1195575728 X:106448350-106448372 CTCAGGTAAATATCTAAGAGTGG - Intergenic
1197936933 X:131749244-131749266 CAAAAGCAAATGGCTAAGAGTGG - Intergenic
1197937600 X:131755536-131755558 CAAAAGCAAATGGCTAAGAGTGG - Intergenic
1197948666 X:131870719-131870741 CATAGGTAAATATCTAAGTGTGG - Intergenic
1200326191 X:155242178-155242200 CACAGGGAACTGTTAAAAAGAGG - Intergenic