ID: 957337745

View in Genome Browser
Species Human (GRCh38)
Location 3:78853762-78853784
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957337742_957337745 17 Left 957337742 3:78853722-78853744 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 957337745 3:78853762-78853784 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957337745 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intronic
Too many off-targets to display for this crispr