ID: 957343985

View in Genome Browser
Species Human (GRCh38)
Location 3:78938879-78938901
Sequence GGGTGTTCAACAATGCGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957343981_957343985 1 Left 957343981 3:78938855-78938877 CCTTTTGAGACAATCAGGTCTGA 0: 1
1: 0
2: 1
3: 13
4: 200
Right 957343985 3:78938879-78938901 GGGTGTTCAACAATGCGAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957343985 Original CRISPR GGGTGTTCAACAATGCGAGG TGG Exonic
1069893861 10:71668317-71668339 CGGTCTTCAACAGGGCGAGGAGG + Intronic
1072520666 10:96227333-96227355 GGGTGTCCAAGATTGCGGGGTGG - Intronic
1080017245 11:27520670-27520692 GGGTTTTCAACTCTGCTAGGGGG + Intergenic
1085216409 11:74836636-74836658 GCATGTTCGACAATGAGAGGCGG + Exonic
1101216174 12:102586402-102586424 GGGTGTTCAAAAATTCCAGCTGG - Intergenic
1102166577 12:110811622-110811644 TGGTGTTCAAATATGCCAGGGGG - Intergenic
1103391467 12:120576790-120576812 GGGGTTTCCACAATGTGAGGGGG + Exonic
1106063227 13:26316418-26316440 GGGTTTGCAACAATGGGAGGAGG - Intronic
1108425339 13:50293461-50293483 GGGTGTTCTCCAATCCAAGGTGG - Intronic
1109683376 13:65783201-65783223 GGATGTTAAACAATGCCATGAGG - Intergenic
1113220682 13:108098323-108098345 GATTGTCCAACAATGCAAGGAGG - Intergenic
1116920757 14:50571125-50571147 GGGCTTCCAACAATGAGAGGTGG + Intronic
1120898919 14:89558954-89558976 GGGTGGGCAAGAATGCGAGGGGG - Intronic
1122023284 14:98857013-98857035 GGGTGATCAATAATGCCTGGTGG + Intergenic
1131528355 15:93170946-93170968 GGGTCCTCAACAATGCAATGGGG - Intergenic
1141367074 16:83453563-83453585 GGGTGTCCTACAATACGAAGTGG + Intronic
1160050638 18:75430138-75430160 GGGTGTTTAACAATGCCACTTGG + Intergenic
1160945750 19:1643095-1643117 GGGTTTCCAAAAATGGGAGGCGG + Intronic
1166094296 19:40529933-40529955 GGGTGTTCAACATAGGGGGGAGG - Intronic
935737004 2:106114165-106114187 GGGTGTTCCACAAACCCAGGCGG + Intronic
937609260 2:123840513-123840535 GGGTGTTGAACAAAGCAAGCAGG - Intergenic
941594680 2:167461051-167461073 GGGCTTGCAACAATGGGAGGGGG + Intergenic
943329953 2:186547136-186547158 GAGTGTTCAACAATGCTGAGTGG - Intergenic
1170879157 20:20279262-20279284 GGGTTTTCAACTTTGTGAGGAGG - Intronic
1171100606 20:22380142-22380164 GGCTGGTGAACAATGTGAGGAGG + Intergenic
1171458090 20:25283084-25283106 GCGTGGGCAACAATGGGAGGAGG + Intronic
1175261444 20:57676739-57676761 GGGTGCTCAGCAGTGCAAGGAGG - Intronic
1180598245 22:16993952-16993974 GGGTGTTCACAAATGCAAGAAGG - Intronic
950850565 3:16058392-16058414 GTGTGTTCATCATTGCTAGGAGG - Intergenic
951909463 3:27734371-27734393 GGGTGCTCAACAATTTGTGGAGG - Intergenic
957343985 3:78938879-78938901 GGGTGTTCAACAATGCGAGGTGG + Exonic
960048411 3:113218869-113218891 TGGTCTTCAACAATGGGAGAAGG + Intronic
961221295 3:125202379-125202401 GGGTGTTCAATCAGGCCAGGCGG + Intronic
970238605 4:13984270-13984292 GTCTGTTGAACAATGCGGGGTGG + Intergenic
975652883 4:76612052-76612074 GGTTTTACAACAATGAGAGGAGG - Intronic
982272208 4:153602375-153602397 GTGCGTTTAACAATGTGAGGAGG + Intronic
990178767 5:53136703-53136725 GTGTGTTCAAAATAGCGAGGAGG - Intergenic
992562048 5:77962568-77962590 GTGTTTTCAAAAATGTGAGGCGG - Intergenic
998014969 5:138724751-138724773 TGGTGTTCTATAATGGGAGGTGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008106135 6:47442768-47442790 GGGTGTTTAAACATGCTAGGTGG - Intergenic
1016954592 6:149614304-149614326 GGGCTTGCAACAATGGGAGGAGG - Intronic
1018253936 6:161899502-161899524 GGGTGTTCATCACTGGGAAGTGG + Intronic
1019702570 7:2481000-2481022 GGGTGCTCAACTCTGGGAGGGGG + Intergenic
1040958541 8:53005829-53005851 TGGTGTTCAACAAGGAAAGGAGG + Intergenic
1046462317 8:114556347-114556369 ATGTGTTCAACACTGAGAGGCGG + Intergenic
1048786548 8:138056702-138056724 GGATGTTCAACAAGGGGAGGTGG - Intergenic
1058932023 9:109730089-109730111 GGGTGTTCAAGAATGAGTAGGGG + Intronic
1059625456 9:116059861-116059883 GGGTGTTCATCAATGAAGGGAGG - Intergenic
1059778177 9:117497874-117497896 GGGCTTGCAACAATGGGAGGAGG + Intergenic
1061875652 9:133542279-133542301 GGGTGTCCAGCAGGGCGAGGTGG + Intronic
1186216929 X:7310687-7310709 AGGTCTTCAACATTGAGAGGTGG - Intronic