ID: 957351807

View in Genome Browser
Species Human (GRCh38)
Location 3:79033235-79033257
Sequence TCCACAAATGTGCCAACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957351807 Original CRISPR TCCACAAATGTGCCAACAAT TGG (reversed) Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900893799 1:5469011-5469033 TCCAAAAATGTGCCACAAGTGGG + Intergenic
901327473 1:8376649-8376671 CCCAGAAATGTGCCAATAAGTGG + Intronic
902982813 1:20138008-20138030 TCCTCAAACCTGCCAACAAGGGG - Intergenic
905968693 1:42122617-42122639 TCCACATCTTTGCCAACACTTGG - Intergenic
906877443 1:49554639-49554661 CCCACAAATGTGTCCAGAATTGG + Intronic
907467393 1:54647988-54648010 TCAACAAATGTTTCAACAAATGG - Intronic
907865332 1:58394215-58394237 TCCACATCTCTGCCAACACTTGG - Intronic
908053951 1:60262726-60262748 TCCATAAAAGTGCCAAAACTGGG + Intergenic
908631173 1:66109427-66109449 TACATAAATGTGTCATCAATTGG - Intronic
908699136 1:66879673-66879695 TCCACATCTTTGCCAGCAATTGG + Intronic
909495780 1:76276803-76276825 TCCACATCTTTGCCAACACTTGG + Intronic
910477272 1:87620496-87620518 TCCACATCTTTGCCAACACTTGG - Intergenic
912973024 1:114301840-114301862 TACACAGAAATGCCAACAATGGG + Intergenic
917624727 1:176834367-176834389 CCCACAAATGTGTCATCATTGGG + Intronic
917830076 1:178873454-178873476 TCCACATTTGTGCTAACAATTGG - Intronic
921914715 1:220594371-220594393 TCCACAAACTTGCCAGCATTTGG - Intronic
922112011 1:222568601-222568623 TCCACATCTGTGCCAACACTTGG - Intronic
923980202 1:239312960-239312982 CCCACAAATGAGCCAGCATTTGG + Intergenic
924471810 1:244349384-244349406 TTCACTTATGTGCCAAGAATTGG - Intergenic
1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG + Intergenic
1065467188 10:26036882-26036904 TTCTCAAAGGTGCCAACAGTTGG - Intronic
1067095439 10:43296394-43296416 TCCACAGGTGTCCCAGCAATGGG + Intergenic
1067566559 10:47342972-47342994 TCCACATTAGTGGCAACAATTGG - Intergenic
1068757791 10:60673805-60673827 TCCCCTAATGTGACTACAATGGG + Intronic
1068917268 10:62445859-62445881 TCCCCATATGTGTAAACAATTGG + Intronic
1069247612 10:66226324-66226346 TTCACAAAAGTGCAAAGAATAGG - Intronic
1072866854 10:99071838-99071860 TCAACAACTGTGCCAAGAATAGG - Intronic
1074422469 10:113321542-113321564 TCCACACATGTTCCAAGACTCGG - Intergenic
1078152251 11:8769143-8769165 TACACAAATGTGTCAGCACTTGG - Intronic
1078239536 11:9518313-9518335 TCCACATCTTTGCCAACATTTGG - Intronic
1079612876 11:22454951-22454973 TCCACAAATAGCCAAACAATTGG - Intergenic
1082873539 11:57965688-57965710 TCCACATCTTTGCCAACACTTGG + Intergenic
1085965548 11:81518959-81518981 TTGACAAATGTTCCAAGAATGGG + Intergenic
1086613378 11:88784345-88784367 TCCACTTATGTGCCCACCATAGG + Intronic
1087533391 11:99412335-99412357 GCCACAAATGTGCCAATTCTAGG + Intronic
1087748914 11:101983888-101983910 TCCATTAATGTGCTAACAAAAGG + Intronic
1094774189 12:33704004-33704026 TCCACAGCTTTGCCAACACTGGG + Intergenic
1095486822 12:42693861-42693883 TCCGCAAATGTTCCAAGAATTGG - Intergenic
1095877340 12:47095870-47095892 CCCACAAATGAGCCAAAAGTTGG - Intronic
1098043269 12:66373615-66373637 TGCACATGTGTGCCAACACTTGG - Intronic
1099708431 12:86187492-86187514 TCCAAGAATGTGGCAACTATTGG + Intronic
1100341983 12:93687882-93687904 TACACACATGAGGCAACAATTGG + Intronic
1104107110 12:125673504-125673526 TCCACATCTTTGCCAACAATGGG - Intergenic
1105552801 13:21413271-21413293 TCCAAAAGTGTGCTAAGAATGGG - Intronic
1107028313 13:35825570-35825592 TCCAAAAATCAGCCAACAGTGGG + Intronic
1109860277 13:68189567-68189589 AAGACAAATGTGCCAAAAATTGG + Intergenic
1110042696 13:70785018-70785040 TGCACAAATGTTCCAACATGTGG + Intergenic
1111263321 13:85773080-85773102 TCCACAAAGGTGTCAATACTAGG - Intergenic
1111342958 13:86912840-86912862 CCCACAAATGTGGGAACTATGGG - Intergenic
1111365850 13:87244012-87244034 TCCACAAATGTGGAACCCATAGG + Intergenic
1111717898 13:91903495-91903517 TCCACATCTTTGCCAACACTTGG + Intronic
1112023124 13:95389345-95389367 TCCACACACTTGCCAACACTTGG + Intergenic
1112133870 13:96553646-96553668 TGCACAGATGTGCCCACATTTGG + Intronic
1112964077 13:105165471-105165493 TCCACATCTCTGCCAACACTTGG - Intergenic
1114226284 14:20741636-20741658 ACCACAAAGGGGCCAATAATGGG + Intronic
1114366255 14:22029887-22029909 TCCACATATTTGCCAATATTGGG - Intergenic
1123425271 15:20165622-20165644 TCCACATGCTTGCCAACAATTGG + Intergenic
1123534495 15:21172156-21172178 TCCACATGCTTGCCAACAATTGG + Intergenic
1124384982 15:29199945-29199967 TCAACAAATGTTGGAACAATTGG - Intronic
1124959556 15:34384256-34384278 TCCACAAAGGTTCAAACAGTGGG - Intronic
1125178255 15:36850812-36850834 TCCACATCTTTGCCAACACTTGG - Intergenic
1125444835 15:39743346-39743368 ACAACAAAGGTGCCATCAATCGG + Intronic
1126180678 15:45782295-45782317 GCCACAAATGCAGCAACAATAGG + Intergenic
1129530678 15:76261765-76261787 TCGACAAATGTGTCAACATTTGG + Intronic
1130637230 15:85635206-85635228 TCCACATCTTTGCCAACATTTGG + Intronic
1130932074 15:88436780-88436802 TCTAGAAATGTGCCAACTCTGGG - Intergenic
1132308014 15:100831681-100831703 CTCACACGTGTGCCAACAATCGG + Intergenic
1133672605 16:8038625-8038647 TCCATATATGTGCCACCCATGGG - Intergenic
1133813032 16:9176029-9176051 TCCACATCTTTGCCAACACTTGG + Intergenic
1136674405 16:31889289-31889311 TCCATAATTATGCCAACACTGGG + Intronic
1136709087 16:32219057-32219079 TCCACATCTTTGCCAACACTTGG - Intergenic
1136758822 16:32710367-32710389 TCCACATCTTTGCCAACACTTGG + Intergenic
1136809285 16:33160017-33160039 TCCACATCTTTGCCAACACTTGG - Intergenic
1136815761 16:33270097-33270119 TCCACATCTTTGCCAACACTTGG - Intronic
1136859585 16:33690121-33690143 TCCACATGCTTGCCAACAATTGG - Intergenic
1139552470 16:67682361-67682383 ACCACAGAAGTGCCAAGAATTGG + Intronic
1141163794 16:81647096-81647118 TCCACACCTTTGCCAACACTTGG + Intronic
1142375346 16:89703882-89703904 TCCAAAAAAGTCCCAAGAATAGG - Intergenic
1203060976 16_KI270728v1_random:970692-970714 TCCACATCTTTGCCAACACTTGG + Intergenic
1203121091 16_KI270728v1_random:1538300-1538322 TCCACATGCTTGCCAACAATTGG - Intergenic
1142770149 17:2090796-2090818 TCAACAAATGTGAGAATAATTGG - Intronic
1144336262 17:14271807-14271829 TCCACATCTTTGCCAACAATTGG + Intergenic
1144432606 17:15208564-15208586 TCCACAAACTTGCCATCATTTGG - Intergenic
1146439217 17:32878646-32878668 TCCACAAATGACCCAACCATAGG - Intergenic
1147519146 17:41152178-41152200 TCAACAAAGATGCCAAGAATGGG - Intergenic
1151010704 17:70492220-70492242 TCCACATCTTTGCCAACAATTGG - Intergenic
1153871147 18:9321574-9321596 TCCATGAATGTGTCAACACTCGG + Intergenic
1155185968 18:23386804-23386826 TTAACAAATGTCCCAGCAATGGG - Intronic
1159167683 18:64723849-64723871 TCCAGATATATGCCAACACTTGG + Intergenic
1159826578 18:73219902-73219924 TTCAGAAATGTGACATCAATAGG + Intronic
1163178622 19:15583475-15583497 TCCCCAAAGGTGCCCACAGTTGG + Intergenic
1166427839 19:42695669-42695691 TTCAAAAATGTTCCAAAAATAGG - Intronic
925593706 2:5534844-5534866 TCCTCAAATGTGCCAAATGTGGG - Intergenic
929532026 2:42758835-42758857 TCAACAAATGTGCCAGTAAAAGG - Intergenic
930246998 2:48994069-48994091 TCAACTACTGTGCCAACATTGGG - Intronic
930442120 2:51422017-51422039 TCCACAGATATGCCATTAATAGG - Intergenic
931740152 2:65235038-65235060 TACAGAAATGTGGGAACAATAGG + Intronic
931955619 2:67420498-67420520 TCATGAAATGTGCCAACATTTGG - Intergenic
932399721 2:71471651-71471673 TCAGCAAATGTGCAAACATTTGG - Intronic
934457947 2:94191231-94191253 TCCACATGCTTGCCAACAATTGG - Intergenic
937344024 2:121111978-121112000 TCCACAACCTTGCCAACATTTGG - Intergenic
940078768 2:149775998-149776020 TCTACACATTTGCCAACATTTGG - Intergenic
940150965 2:150600089-150600111 TCCACATTAGTGCCACCAATAGG - Intergenic
941447232 2:165617533-165617555 TCCACACATGTGCCACCTAGGGG - Intronic
944758850 2:202792195-202792217 TCCACATCTTTGCCAACATTTGG - Intronic
947224805 2:227829800-227829822 TGCACTAATGTGCAAACAGTTGG - Intergenic
947609592 2:231515612-231515634 TCCATAAATGTGCCAAAATATGG + Intergenic
1169848621 20:10025001-10025023 TTAACAAATGTGCCAAATATTGG + Intronic
1170877209 20:20261571-20261593 TCCCCAAATGGGCCACCACTTGG - Intronic
1173909390 20:46652892-46652914 TCCACATCTTTGCCAACATTTGG + Intronic
1176050912 20:63119350-63119372 CCCACAACTGTGCCAACACAGGG + Intergenic
1177205894 21:18010991-18011013 TACTCAAATGTTTCAACAATGGG + Intronic
1178167143 21:29992046-29992068 TGCCCAACTGTGCCAAGAATTGG - Intergenic
1182514126 22:30843310-30843332 TCTACGAATTTGCCACCAATGGG - Intronic
1183087272 22:35494058-35494080 TCCACAAATGTGCCAAGTTGTGG - Intergenic
949778652 3:7660815-7660837 CCCACAAATGTGTGAACAACTGG + Intronic
949833370 3:8241276-8241298 TCCACATCCTTGCCAACAATTGG - Intergenic
955878650 3:63520942-63520964 GACACAAATGTGCAAACATTTGG - Intronic
956291498 3:67665163-67665185 TCCACAATTGTACCCACATTGGG - Intergenic
957351807 3:79033235-79033257 TCCACAAATGTGCCAACAATTGG - Intronic
959457469 3:106580604-106580626 TCCTTAAATGTGGCATCAATAGG + Intergenic
959905191 3:111703396-111703418 TGCAGAAATGTGACAGCAATGGG - Intronic
960091072 3:113638424-113638446 TCCACATCTTTGCCAACATTTGG + Intergenic
964150317 3:153516941-153516963 TCAACAAAGGTGCCAACAATGGG - Intergenic
964666961 3:159185217-159185239 TCTACAAATGTGCCTACTAATGG + Intronic
964833738 3:160914075-160914097 TCCACATCTTTGCCAACACTTGG + Intronic
964998916 3:162926851-162926873 TCCACCAATGTGGCCACAAATGG - Intergenic
967370839 3:188744294-188744316 TCCACAAAATTGCCCAAAATGGG + Intronic
968397894 4:260599-260621 TCCACAATTATGCCACCATTTGG + Intergenic
969949548 4:10820383-10820405 TCCACAAACTTGCCAATAGTGGG + Intergenic
972593074 4:40506475-40506497 TCCACAAAGATTCCAACCATGGG - Intronic
973293918 4:48494911-48494933 TTCACAAATGTGGCAAAAGTGGG + Intergenic
975354767 4:73388768-73388790 TCCACCAATGTGTTAAAAATGGG + Intergenic
976817366 4:89164657-89164679 TGCACAAAAGTGCCATCTATAGG - Intergenic
979191299 4:117862528-117862550 TTTGCAAATGTGACAACAATGGG - Intergenic
982735390 4:159001143-159001165 TCCACATCTTTGCCAACACTTGG + Intronic
983333970 4:166368426-166368448 TCAACAAAGGTGCCAAGAACAGG - Intergenic
983586025 4:169355520-169355542 TCCACATCTCTGCCAACACTTGG - Intergenic
983717914 4:170808259-170808281 TCCCCAAATGCCCCCACAATAGG - Intergenic
987002650 5:13675770-13675792 TCCAGAAATATGCCAGCAGTTGG + Intergenic
987514208 5:18885124-18885146 TCCACAAATTGGCCAGCACTAGG + Intergenic
987623836 5:20371571-20371593 TCTAGAAATGTGCCTGCAATGGG + Intronic
989796672 5:45482787-45482809 AACATAAATGTGCAAACAATAGG - Intronic
990511004 5:56488925-56488947 TCCCCTAATGTGCCCAGAATTGG - Intergenic
990697529 5:58437531-58437553 GCCACATAGGTGCCAAGAATGGG + Intergenic
991338521 5:65578477-65578499 TCCACATCTGTGCCACCATTTGG + Intronic
995812083 5:116119022-116119044 TCAACAAATGTTCTCACAATTGG - Intronic
997771855 5:136562488-136562510 GCCACAAATGTGCCTAGAAAAGG + Intergenic
998729434 5:145057678-145057700 ACCACAATTGTGCAAGCAATTGG - Intergenic
1004582134 6:16964688-16964710 TCCAGCAATGTGCCAAGAAAGGG - Intergenic
1007205142 6:40143707-40143729 TACAGAAATGTGCTCACAATGGG - Intergenic
1012539162 6:100340441-100340463 TCCACATCTTTGCCAACACTTGG - Intergenic
1012782655 6:103582428-103582450 TTCACTAAGGTGCAAACAATGGG - Intergenic
1013412768 6:109896617-109896639 TCCACAAATCTTCCAACATGTGG + Intergenic
1013620367 6:111881957-111881979 TCCACAAATCTGGAGACAATAGG - Intergenic
1016657161 6:146532875-146532897 TCCACATCTTTGTCAACAATTGG + Intergenic
1017230295 6:152066495-152066517 TTCTCCAATGTGACAACAATGGG - Intronic
1017587019 6:155937750-155937772 TCCACCAATGAGCCAATAATGGG + Intergenic
1020626316 7:10584413-10584435 TACACTAATGTGACAACAATAGG - Intergenic
1020689412 7:11336482-11336504 TAAACAAATGTGCCTACAATTGG - Intergenic
1021179446 7:17488793-17488815 TCCAGAAAGGTGGCAACACTGGG + Intergenic
1021603728 7:22390276-22390298 TTCATAAATGTGCCAACATTCGG + Intergenic
1022189391 7:28002413-28002435 ACAACAAATGTGCCAATAAGAGG - Intronic
1023269502 7:38446163-38446185 TCCACATCTTTGCCAACAGTTGG - Intronic
1024535932 7:50433164-50433186 TCCAAATATTTGCCAACACTGGG + Intergenic
1026055700 7:66981811-66981833 TCCAAAAAAGTGACAAAAATGGG + Intergenic
1026721992 7:72839998-72840020 TCCAAAAAAGTGACAAAAATGGG - Intergenic
1030489689 7:110216130-110216152 TCCACATATGTGACAATCATTGG - Intergenic
1030707397 7:112708466-112708488 TCCACCAATGAGCCAGCAGTGGG - Intergenic
1031440104 7:121784005-121784027 TCCACATCTGAGCCAACAGTTGG - Intergenic
1032701567 7:134384477-134384499 TCAACAACTGTGTTAACAATTGG - Intergenic
1032980542 7:137277269-137277291 TCCACATTTTTGCCAACACTTGG - Intronic
1036592407 8:10180884-10180906 TTCAAAAATGTGGCAACATTTGG - Intronic
1039908665 8:41806903-41806925 TCCACAGATGTGAGAAAAATAGG + Intronic
1040573776 8:48632862-48632884 TCCACAAATGTTAAAAGAATGGG - Intergenic
1041791830 8:61704822-61704844 TCTACATATGTACCAACATTTGG - Intronic
1042316019 8:67426857-67426879 TCCACAACTGTAACAAGAATTGG - Intronic
1042372294 8:68005593-68005615 TGGACAAATGCACCAACAATTGG - Intronic
1042746252 8:72109969-72109991 TCCACAACTTTGTCAACACTTGG + Intronic
1043119459 8:76304394-76304416 TCCACAAAATTGCTAACAGTGGG + Intergenic
1045541769 8:103093301-103093323 TCCACAAATGGAACAAAAATTGG - Intergenic
1046575533 8:116024136-116024158 TCCAAAGATTTGCAAACAATGGG + Intergenic
1048548519 8:135409806-135409828 TCCACACATTTGCCAGCAATTGG + Intergenic
1052155523 9:25183959-25183981 TTGACAAAGGTGCCAAGAATGGG + Intergenic
1053688456 9:40567036-40567058 TCCACATGCTTGCCAACAATTGG - Intergenic
1054275574 9:63064022-63064044 TCCACATGCTTGCCAACAATTGG + Intergenic
1054299697 9:63367947-63367969 TCCACATGCTTGCCAACAATTGG - Intergenic
1054399259 9:64700909-64700931 TCCACATGCTTGCCAACAATTGG - Intergenic
1054432837 9:65185174-65185196 TCCACATGGTTGCCAACAATTGG - Intergenic
1054497548 9:65836501-65836523 TCCACATGGTTGCCAACAATTGG + Intergenic
1057098736 9:92337746-92337768 TGCACAAATGTGCTATGAATGGG - Intronic
1186563480 X:10637839-10637861 TGGACAAATGTGCCACCATTAGG + Intronic
1190091901 X:47445516-47445538 TCCACATACTTGCCAACATTTGG - Intergenic
1194270198 X:91804006-91804028 TCCACAATTTAGCCAACAGTGGG - Intronic
1197895621 X:131310863-131310885 TCCACATCTATGCCAACAATTGG - Intronic
1200258164 X:154596858-154596880 TCCACAAACGTGCCAGCAGATGG + Intergenic
1200587436 Y:5025444-5025466 TCCACAATTTAGCCAACAGTGGG - Intronic