ID: 957354061

View in Genome Browser
Species Human (GRCh38)
Location 3:79059290-79059312
Sequence GAGCTGAGGCATTAGATCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957354061 Original CRISPR GAGCTGAGGCATTAGATCAG GGG Intronic
903315694 1:22503518-22503540 GGGCTTAGCCATTATATCAGTGG - Intronic
906967357 1:50471671-50471693 GGGCTGTGTCATTATATCAGTGG + Intronic
908690114 1:66770027-66770049 GAGGAGAGGCTTTATATCAGTGG + Intronic
908754159 1:67452700-67452722 GAAGTGGGGCATGAGATCAGTGG + Intergenic
912687195 1:111776901-111776923 GGGCTCATGCATTAGATAAGGGG + Intronic
915119445 1:153619543-153619565 CAGCTGGGTCACTAGATCAGGGG + Intronic
917640661 1:176980343-176980365 GAGCTGAGGCCTGAGGACAGTGG + Intronic
919934520 1:202242801-202242823 GATCAGAGGCATGAGATGAGGGG - Intronic
920792029 1:209102246-209102268 GAGATGATGCAATAGATAAGAGG + Intergenic
922440106 1:225648125-225648147 GAGCTGAGGCTGTACTTCAGTGG - Intronic
924071092 1:240279594-240279616 GAGTGGAGGAATTAGAACAGAGG + Intronic
1064806771 10:19143844-19143866 GAACCGAGGGATTAGACCAGAGG + Intronic
1067689891 10:48494929-48494951 GAGCTGAGGCTTTAAATGAGAGG - Intronic
1069408779 10:68130896-68130918 GAGCTGACACTATAGATCAGTGG - Intronic
1072867868 10:99083607-99083629 AAGCTGAGGCAGTAAATCTGGGG - Intronic
1076042835 10:127265987-127266009 GAGCTGAGGGCTTGGATCAGGGG + Intronic
1077071905 11:678564-678586 TTGTTGATGCATTAGATCAGTGG - Intronic
1078644584 11:13128773-13128795 GAGCTTGGGCATTAGTTCATGGG - Intergenic
1081303085 11:41477639-41477661 GTGCTCAGGCATTAGATGATTGG + Intergenic
1084568662 11:69945982-69946004 GAGCTGAGGACTTAGAGAAGAGG + Intergenic
1088688716 11:112306315-112306337 GAGCTGGGTAATGAGATCAGAGG + Intergenic
1089970702 11:122690898-122690920 GAGCTGAGGAACTTGATCACTGG + Intronic
1091671232 12:2453641-2453663 GAAAGGAGGGATTAGATCAGAGG - Intronic
1095566090 12:43624927-43624949 GAGAAGAGGCATAATATCAGAGG - Intergenic
1096985319 12:55752295-55752317 GAGCTGGGGCATTAAATATGGGG + Exonic
1102284702 12:111646386-111646408 GAGCTGAGACATGAGAAAAGAGG + Intronic
1104574351 12:129953186-129953208 GTGCTGAGGCATTACTTCAGTGG - Intergenic
1104656591 12:130578205-130578227 GAGCTGGGGCAGAAGCTCAGAGG + Intronic
1105268346 13:18844282-18844304 GACCTGATTCATCAGATCAGAGG + Intergenic
1105291257 13:19055207-19055229 GAGCTGTGGCAGTAGCTCTGTGG - Intergenic
1105346905 13:19581643-19581665 CAGCTGAGGCATCAGATGTGTGG - Intergenic
1108664546 13:52616871-52616893 CAGCTGAGGCATCAGATGTGTGG + Intergenic
1108715835 13:53077009-53077031 GAGCTGAGGCAGGACATGAGTGG + Intergenic
1111968575 13:94886248-94886270 GAGCTGAGTCATTTGAGCAGTGG - Intergenic
1113576910 13:111401603-111401625 GAGCAGAGGCATTGGTGCAGAGG - Intergenic
1114696288 14:24630553-24630575 GAGCTGAGCCTTGAGCTCAGAGG + Intergenic
1116773440 14:49152939-49152961 GGGCTCAGGCATTAGACCAGGGG + Intergenic
1119020993 14:71114680-71114702 GAGCTGAGGCATAAGAAAAAAGG - Exonic
1119033167 14:71208212-71208234 GAGCTGAGGAATTCAAGCAGAGG + Intergenic
1120451574 14:84674637-84674659 GAGCTAAGGGATTAAATCACTGG - Intergenic
1121736352 14:96220698-96220720 GGGCTGAGGCACCAGACCAGAGG - Intronic
1122189534 14:100029739-100029761 GAGCTGAGGTATAGGAACAGGGG + Intronic
1122410203 14:101521843-101521865 GAGCTGGGGCATCAGAGCGGGGG - Intergenic
1124207910 15:27738963-27738985 GAGCAGAGGCATTGGACAAGGGG - Intergenic
1127295581 15:57605975-57605997 GAGTAGAGGCACGAGATCAGAGG + Intronic
1130556084 15:84923526-84923548 GAGCTTGGGCATTGGATGAGGGG - Intronic
1132854813 16:2040024-2040046 GAGCTGTGGCACGAGATCAATGG - Exonic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136413013 16:30087823-30087845 GGGGTGAGGTATTAGATAAGAGG - Intronic
1137672907 16:50289988-50290010 GAGCTGAGGCAATGGCACAGAGG - Intronic
1144078771 17:11743413-11743435 GATCTGAGGAATTAGAAGAGAGG - Intronic
1146505628 17:33402146-33402168 GAGCTGAGGGGTTAGATCTGAGG + Intronic
1147841573 17:43375568-43375590 GAGCTGATTCATCAGAACAGGGG + Intergenic
1148382063 17:47207075-47207097 GAGGTGAGGCAGAAGATGAGGGG + Intronic
1150259403 17:63775789-63775811 GATCTGAGGGTTTCGATCAGAGG + Intronic
1150430402 17:65111282-65111304 GGGCTGAGGCCTTAAATCTGTGG - Intergenic
1151043677 17:70894405-70894427 CAGCTGAAGAACTAGATCAGGGG - Intergenic
1160804622 19:986819-986841 TAGCTGTGGCGTTAGATCACCGG + Intronic
1165227432 19:34365032-34365054 GAGCTGAGGCCCCAGATCAGCGG + Intronic
1167876229 19:52414944-52414966 GAGGTGATGCATTGGAGCAGTGG - Intronic
927981551 2:27377976-27377998 GAGCAGAGGCATAAGGACAGCGG + Exonic
933815820 2:86068180-86068202 GACCTGAGGCATTAGCTATGTGG - Intronic
935334122 2:101999335-101999357 AAGCTCTGGCATTAGAGCAGCGG - Intronic
936617461 2:114062679-114062701 GAGCTGAGGCATTTGATGGTGGG + Intergenic
938950363 2:136249478-136249500 TTGCTGAGGCACGAGATCAGAGG - Intergenic
942951782 2:181729664-181729686 GTGCTTATGCATAAGATCAGTGG + Intergenic
945546569 2:211160556-211160578 AAGCTGAGTTATTAGATTAGGGG + Intergenic
946902185 2:224383415-224383437 GAGCTGTGGAATTAGAGCAAAGG - Intronic
948285717 2:236783613-236783635 GAGCAGAGGCAAGAGATGAGAGG - Intergenic
948373373 2:237504748-237504770 GAGCTGAGTCTTCAGATTAGAGG - Intronic
1169600016 20:7247843-7247865 GAGCTTAAGCATTAGTTAAGAGG + Intergenic
1170547421 20:17446273-17446295 GAGGTGAGGATTTAAATCAGAGG + Intronic
1170827502 20:19809171-19809193 CAGCTGGGGCAGAAGATCAGGGG + Intergenic
1172270879 20:33655121-33655143 GAGCTGTGGAAGTAGAGCAGAGG - Intergenic
1176289710 21:5037576-5037598 GAGGTGAGGCCTGAGCTCAGGGG + Intronic
1178515719 21:33245590-33245612 CAGCAGAGGCATTAGCTTAGGGG - Intronic
1178891270 21:36522927-36522949 GAGCAGAGGAATTTGTTCAGGGG + Intronic
1179365127 21:40751932-40751954 GAACAGAGGCATCAGATCAGTGG - Intronic
1179867520 21:44226011-44226033 GAGGTGAGGCCTGAGCTCAGGGG - Intronic
1183596409 22:38815165-38815187 GTTCTGAGGCAGTAGATCTGGGG - Intergenic
950865217 3:16183309-16183331 GAGCTGAGGCCTTAGAAGAATGG - Intronic
953676601 3:45007573-45007595 GAGGTGAGGCCTTAGTTCTGAGG + Exonic
954413856 3:50383332-50383354 GAGCTGAGGCAGTGGCTCTGGGG + Intronic
955149937 3:56356983-56357005 GAGTTTAGGCATGAAATCAGGGG + Intronic
956687147 3:71840569-71840591 GGGATGAGGCATTGGATCTGAGG + Intergenic
957354061 3:79059290-79059312 GAGCTGAGGCATTAGATCAGGGG + Intronic
959595670 3:108126026-108126048 GAGATGAGGCACTAGACCACTGG - Intergenic
964042361 3:152276877-152276899 GAGATGAGGGACTAGATGAGGGG + Intronic
964237171 3:154545230-154545252 GAGCTGAGGCCTTAGGTATGGGG + Intergenic
964447182 3:156771773-156771795 TAGTTGAGGCAAGAGATCAGTGG - Intergenic
969204437 4:5632808-5632830 GAGCTGAGATATTATCTCAGAGG + Intronic
969840966 4:9881496-9881518 GAGCTGAGGAACTATAGCAGGGG + Intronic
970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG + Intronic
970254415 4:14152818-14152840 AGTCTGAAGCATTAGATCAGAGG - Intergenic
972381504 4:38524352-38524374 TAGGTGGGGCAATAGATCAGTGG + Intergenic
977748843 4:100583867-100583889 CAGCTGAAGAATTAAATCAGAGG - Intronic
980915469 4:139029454-139029476 GAGCTGAGGCTTTAGCTATGAGG + Intronic
981322498 4:143409124-143409146 GAGCTGATGCCTTATCTCAGGGG + Intronic
983927371 4:173416416-173416438 GAGCAGAGGTATGAGATCATCGG - Intergenic
985816892 5:2134011-2134033 GAGCTGAGGCATGTGGACAGAGG + Intergenic
986594769 5:9409750-9409772 GACACGAGGCATTAGATCGGGGG + Intronic
986708671 5:10471700-10471722 GAGCTGTGGCTTTAGTACAGGGG + Intronic
988211209 5:28206588-28206610 GAGGAGAGGCATTACATCAAAGG - Intergenic
990966922 5:61458546-61458568 AAGCTGAAGGACTAGATCAGTGG - Intronic
993817756 5:92573429-92573451 GAGCTGATGCTGTTGATCAGGGG + Intergenic
998794128 5:145799536-145799558 GAGGTGAAGCATTCCATCAGAGG + Intronic
999331165 5:150674300-150674322 TACATGAGGCATGAGATCAGTGG - Intronic
999448265 5:151658741-151658763 GAGCTCAGACATTAACTCAGTGG + Intergenic
999640947 5:153672734-153672756 GAGCCAAGGAATTAGAGCAGCGG - Intronic
1001315314 5:170637528-170637550 GATCTGAGGGAATAGAGCAGAGG - Intronic
1001332450 5:170771999-170772021 GAGCAGTGGCCTTAGGTCAGGGG - Intronic
1006522997 6:34582829-34582851 GAGCTGAGCCATTTGAGCTGGGG + Intergenic
1007201786 6:40115770-40115792 CATCTGATGCATTAGGTCAGAGG + Intergenic
1007483087 6:42162874-42162896 GAGCTGAGGCATTGGATACTGGG - Intronic
1007833149 6:44654202-44654224 GAGCTGAGGCATTCTCTTAGGGG - Intergenic
1010250621 6:73703458-73703480 GAGGTGAGGCATGGGATCTGGGG + Intronic
1010791382 6:80069158-80069180 GGGCTGATGAATTAGATGAGTGG + Intergenic
1011793485 6:90926253-90926275 CAGCTGAAGGAATAGATCAGAGG + Intergenic
1012178154 6:96115647-96115669 GAACCGAAGCATTATATCAGCGG - Intronic
1012534912 6:100283738-100283760 GAACTGAGGAATTTGATAAGAGG - Intergenic
1015913951 6:138196115-138196137 GTGCTAAGGCATGAGCTCAGGGG + Intronic
1021233938 7:18119587-18119609 GAGCTTAGCCAGTTGATCAGAGG + Intronic
1021683573 7:23159128-23159150 GAGCTGAAGGACTAGATCATTGG + Intronic
1026579712 7:71604834-71604856 GACTTGAAGCATTAGATTAGAGG - Intronic
1027603799 7:80274038-80274060 GAGGTGAGGCATTTTATCACTGG - Intergenic
1028850818 7:95535353-95535375 TAGGTGAGGCATTAGAAGAGAGG - Intronic
1029094039 7:98071132-98071154 GAGCTCTGGCATGAGATCAGAGG + Intergenic
1030687928 7:112505754-112505776 GGGCTGAGTCATGAGATAAGGGG + Intergenic
1037112233 8:15177380-15177402 GAGCTGAGGCCTTACCTCAATGG + Intronic
1038242770 8:25825188-25825210 GAGCTGAAGAATTAGACTAGAGG - Intergenic
1039493604 8:37965421-37965443 GGGCTGCGGCAGTAGATGAGCGG + Exonic
1042211188 8:66382037-66382059 AAGATGAGGCTTTAGAGCAGAGG - Intergenic
1043577306 8:81672853-81672875 GTCCTGGGGCATCAGATCAGAGG + Intronic
1046136853 8:110038175-110038197 GAGCTGAGAAATAAGGTCAGAGG - Intergenic
1046767357 8:118084119-118084141 GAGCTTGGTGATTAGATCAGTGG - Intronic
1048105449 8:131403493-131403515 CAGCTGAGGGAGGAGATCAGCGG + Intergenic
1053044029 9:34898939-34898961 GAGCTGAGGAATTAGAGCCAAGG + Intergenic
1054484183 9:65703735-65703757 CAGCAGAGGCCTTAGATGAGTGG + Intronic
1055269892 9:74546088-74546110 GAGCTTTGGCATCTGATCAGTGG + Intronic
1056224632 9:84483028-84483050 GAGGTCAGGCATTAGGTCTGGGG + Intergenic
1057221890 9:93261932-93261954 GAACTGAGGCAGGAGCTCAGGGG - Exonic
1057270366 9:93646954-93646976 GAGCTGTGGCACTAGCTCTGTGG + Intronic
1059768832 9:117408942-117408964 GAGTAGAAGAATTAGATCAGAGG + Intronic
1060770418 9:126327638-126327660 GAGCTGAGGCATGGCACCAGGGG + Intronic
1061059602 9:128243795-128243817 AGGCTCAGGCATGAGATCAGGGG - Intronic
1190834376 X:54086956-54086978 GAGCTGAGGCACTAGAGCAGGGG - Intronic
1191750471 X:64536721-64536743 TAGCTCAGCCAGTAGATCAGAGG - Intergenic
1191898628 X:66019084-66019106 GAACTGAGGCATTATATCTGAGG + Intergenic
1192341223 X:70265051-70265073 TGGATGAGGCATTAGCTCAGTGG - Intergenic
1194693628 X:97017649-97017671 GAGCTGCGCCATAAGATCACAGG - Intronic
1196846598 X:119901380-119901402 GAGTAGAGGCATTACAGCAGAGG - Intronic
1198575818 X:138009313-138009335 GAGTTGAGGCAAGAGGTCAGCGG + Intergenic