ID: 957361933

View in Genome Browser
Species Human (GRCh38)
Location 3:79172126-79172148
Sequence GGGAGGCTTAGAGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957361933_957361937 8 Left 957361933 3:79172126-79172148 CCTCAATTTGCTCTAAGCCTCCC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 957361937 3:79172157-79172179 CTTTGATGAATAAGATCCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957361933 Original CRISPR GGGAGGCTTAGAGCAAATTG AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902730879 1:18368113-18368135 GAGAGGCTTAGAGCAGACTCTGG - Intronic
904422062 1:30400548-30400570 GGGAGGATTCCAGGAAATTGTGG - Intergenic
904577052 1:31511584-31511606 GGGAAGCAAAGAGCAGATTGGGG + Intergenic
904834471 1:33325955-33325977 GGGAGGCCTAAAGGAAAGTGAGG + Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906520963 1:46466669-46466691 GGGAGGCTCAGCGCGATTTGCGG - Intergenic
906524369 1:46485823-46485845 GGGCGGCTTAGACCTAATTCCGG - Intergenic
907167278 1:52424830-52424852 GGTAGGCTTAGACCATATTATGG - Intronic
907936557 1:59047045-59047067 GTTAGGCACAGAGCAAATTGTGG + Intergenic
908280210 1:62525590-62525612 GGGAGGGAGAGATCAAATTGAGG + Intronic
909782722 1:79567141-79567163 GAAAGTCTTAGAGAAAATTGAGG + Intergenic
916513278 1:165492542-165492564 TGGAGGCTTTGAGCATCTTGAGG - Intergenic
917529906 1:175825498-175825520 GGGAGGCTTGAAGGAGATTGAGG + Intergenic
920697306 1:208191016-208191038 GGGAGGCTATGAGCTAAGTGAGG + Intronic
923638554 1:235726176-235726198 AGGAAGCTCAGAGCAAATTTAGG + Intronic
1063361543 10:5463265-5463287 GGGTGGCTTAGAGGAAGGTGGGG - Intergenic
1070129344 10:73646267-73646289 GGGTGGCTTAGTGCAAACAGGGG + Exonic
1072796573 10:98360360-98360382 GGGAGGCTTAGGGAGAAATGAGG + Intergenic
1073394094 10:103203944-103203966 GGGAGTCTCAGAGCACATTTTGG + Intergenic
1073997115 10:109328243-109328265 GGGAAGCTTAGTGCCAATGGAGG + Intergenic
1079250603 11:18784667-18784689 GGGAGGCTTTTATTAAATTGTGG - Intronic
1080149756 11:29037344-29037366 GGGAGGATTAGGGAAACTTGTGG - Intergenic
1082302858 11:50531439-50531461 GGGATATTTAGAGCACATTGAGG - Intergenic
1082987774 11:59182779-59182801 GTGAGGCTTAAAGAAGATTGTGG + Intronic
1089753573 11:120669260-120669282 GGGAGGCTAAGAGCATCCTGAGG + Intronic
1092004820 12:5060475-5060497 GGTAGGCTTTGAACAAACTGAGG + Intergenic
1095064811 12:37758189-37758211 GGGATATTTAGAGCAATTTGAGG + Intergenic
1095167714 12:38993244-38993266 GGGAGGATTATAACAAATTTGGG - Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG + Intronic
1097809030 12:63998521-63998543 TGGGTGCTTAGAGCAAAGTGTGG - Intronic
1103202637 12:119100828-119100850 GGGAGGTTTAGGGAAAACTGAGG + Intronic
1105587408 13:21757684-21757706 GAGAAGCTTAGAGAAACTTGGGG + Intergenic
1105661066 13:22495888-22495910 GGGAGGCTTAAAGTAAAGTGTGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1105915172 13:24908507-24908529 GGGAGGCTGAGAGCAAGCAGAGG + Intronic
1106295379 13:28408784-28408806 CGGAGGCTTGGAGCAAAGAGAGG - Intronic
1107570454 13:41652043-41652065 GGGAGGATAAGGCCAAATTGGGG + Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1110501890 13:76238077-76238099 GGGGGGCTTAGGGCAAGTTGGGG + Intergenic
1113221273 13:108105835-108105857 GGAAAGCTTAGAGCAAATGTTGG + Intergenic
1113560513 13:111275849-111275871 GAGAGGCTTAGAGCTGAGTGTGG + Intronic
1113584650 13:111456897-111456919 GGGAGGCTTTGCCCACATTGCGG - Intergenic
1113596442 13:111537392-111537414 GGAAGGCTTAGGGCAGATTTTGG + Intergenic
1113639808 13:111949279-111949301 GGGAGGCTGATGGCATATTGGGG + Intergenic
1113892955 13:113746037-113746059 AGAAGGCTTTGGGCAAATTGGGG - Intergenic
1114948929 14:27722415-27722437 GTGAAGCTTAAAGCAAATTATGG + Intergenic
1116789203 14:49321724-49321746 TGGAGGCTTGGACCAAAATGGGG + Intergenic
1117169127 14:53072995-53073017 GGGATACTCAGAGCAAAATGAGG + Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1121932387 14:97984301-97984323 GGGAGCTCAAGAGCAAATTGGGG - Intergenic
1125185475 15:36924893-36924915 GGGAGCCTGAGAGGAAATTAAGG - Intronic
1127074976 15:55316809-55316831 GGATGGCTCAGATCAAATTGAGG - Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1141106456 16:81237755-81237777 GGGAAGCTCAGATCAAATTCAGG + Intergenic
1141378724 16:83556165-83556187 GAGAGGCTTAGAGACAATTTGGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144266228 17:13572453-13572475 TGGAGGCTTAGAGAAAGTCGGGG + Intronic
1144335540 17:14265962-14265984 GAGATGCTTAGAGCAAGTTATGG + Intergenic
1145730197 17:27175321-27175343 GGAAGTTTTGGAGCAAATTGAGG + Intergenic
1146113984 17:30117332-30117354 GGTAGGCATATAGGAAATTGGGG + Intronic
1147705988 17:42425120-42425142 GGAAGGCTTAGAGCAGAAGGTGG - Intergenic
1148557696 17:48588319-48588341 GGATGGCAAAGAGCAAATTGGGG - Intronic
1149775240 17:59352020-59352042 GGGAGGTTTAGAGGAAAAAGAGG + Intronic
1150649202 17:66998925-66998947 GGGAGGCCTAGCCCAAATGGTGG - Intronic
1151053100 17:71002038-71002060 GGGAAGCTTTGAGCCAAATGTGG - Intergenic
1151889497 17:76943781-76943803 TGGAGGCTGAGAGCAAATGAGGG + Intronic
1152269654 17:79316549-79316571 GGGAGGTCTTGAGCAAAATGAGG + Intronic
1152625084 17:81384327-81384349 GGGAGGCTGGGGGCAAACTGAGG + Intergenic
1152843445 17:82585086-82585108 TGGGGGCTTAGAGCAAAGAGAGG - Intronic
1152847618 17:82611824-82611846 GGGAGGCTCAGAGCAAATGTCGG + Intronic
1158304450 18:56089342-56089364 GGGAGGCTCATAGCCATTTGGGG - Intergenic
1163889211 19:19995991-19996013 GGGAGGCACAGAGCAGATGGTGG + Intergenic
1167491477 19:49795163-49795185 GGGAGGCTCAGAGCCGAGTGAGG + Intronic
1167609185 19:50498319-50498341 GGGAGACTGAGAGAAAGTTGGGG + Intergenic
1202638551 1_KI270706v1_random:62477-62499 GGGAGGGTTGGAGGAGATTGTGG - Intergenic
926735176 2:16068293-16068315 GGGAGGCCCAGAGCAAATCCAGG + Intergenic
927027856 2:19088751-19088773 GGCAAGATTAAAGCAAATTGAGG - Intergenic
927650995 2:24913678-24913700 GGGAGGGTGAGAGGAAACTGAGG - Intronic
931464016 2:62471227-62471249 GGGAAGCTTAGAACCAATTGGGG + Intergenic
931988241 2:67761903-67761925 GGGAAGCTTAGGGCAGCTTGAGG - Intergenic
932509996 2:72276854-72276876 GGAAGACTTAAAGCAAGTTGAGG - Intronic
933621034 2:84541639-84541661 GGGAGAGTTAGAGAAAAGTGAGG + Intronic
939288889 2:140167898-140167920 GGGAGGCTGAGAACAAAATGTGG + Intergenic
941687357 2:168460801-168460823 GGGAGGCTGACAGCAAAGTCTGG + Intronic
942267464 2:174242779-174242801 GTGAGGCTTAGAGAATATTGGGG - Intronic
946777087 2:223154461-223154483 GGCAGTCTGAGATCAAATTGTGG + Intronic
1169226407 20:3859766-3859788 GGGAGGGTGAGAGCAGATGGAGG - Intronic
1169236849 20:3936531-3936553 GGGAGGCTGAGAACAAGCTGTGG + Intronic
1169660342 20:7972257-7972279 TGGAGGCTTTGAGCAGATTTAGG + Intergenic
1170032700 20:11959341-11959363 GGGAGGGTTAGAGGAAAGAGAGG + Intergenic
1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG + Intergenic
1170584924 20:17727495-17727517 AGGAGGCTTAGACTAAATTTGGG + Intronic
1171844942 20:30262521-30262543 GGAAGTTTTGGAGCAAATTGAGG - Intergenic
1172170646 20:32929767-32929789 AGGAGGCTGAGAGCATAGTGAGG - Intronic
1172343437 20:34177954-34177976 GGGAGGCTAAGACCAGCTTGAGG + Intergenic
1172390030 20:34559856-34559878 GGGAGGCGTAGACCATATAGAGG - Exonic
1174374457 20:50116464-50116486 GGGAGGTTTTGAGCTAAATGTGG + Intronic
1177351322 21:19945666-19945688 GGCAAGCTTAGAGCAAAATCAGG - Intergenic
1177583017 21:23052398-23052420 GGAAGGCTTAGATAAAATTTTGG - Intergenic
1177801376 21:25832120-25832142 CGGAGGGTTGGAGCAAAGTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1180363415 22:11919411-11919433 GGGAGGGTTGGAGGAGATTGTGG + Intergenic
1181545987 22:23602691-23602713 GGGGTGCTTAGAGAAATTTGGGG + Intergenic
1181800529 22:25345154-25345176 GGGGTGCTTAGAGAAATTTGGGG - Intergenic
1182917053 22:34043662-34043684 AGGAGGCATTGAGCAGATTGTGG + Intergenic
1183027987 22:35080555-35080577 GGGAGGTGTAGAGCTAATTATGG - Intronic
951785643 3:26415817-26415839 GAGAGACTAAGAGAAAATTGTGG + Intergenic
957361933 3:79172126-79172148 GGGAGGCTTAGAGCAAATTGAGG - Intronic
958272747 3:91526185-91526207 TGGATGTTTAGAGCACATTGGGG - Intergenic
960092987 3:113660638-113660660 GGGAGGCTGCGAGCAGACTGTGG + Exonic
961378661 3:126483133-126483155 GGGAGGCTTGGAGCAAAGGCGGG - Intronic
962938448 3:140103419-140103441 GGGAGGTTGACAGAAAATTGTGG - Intronic
963211276 3:142694257-142694279 GAGAGATTTAGAGCAAATGGAGG + Intronic
963490419 3:145993353-145993375 GGAAAGCTAAGAGCAAACTGGGG + Intergenic
966565393 3:181375164-181375186 GGGAGGCATAGACCAAATCCAGG + Intergenic
966883256 3:184361585-184361607 GGGAGGCCGAGAGCAGAGTGCGG + Exonic
969030718 4:4210894-4210916 GGGTCGTTTAGAGGAAATTGAGG - Intronic
971065860 4:23032417-23032439 GGCTGGCTTATAGCAAATGGAGG - Intergenic
974568116 4:63606062-63606084 GGGAGATTTAGGGCAAAATGTGG - Intergenic
975974641 4:80080933-80080955 TGGAGGCTTAGACAAAATTGAGG + Intronic
979689487 4:123545575-123545597 GAGAGGCTAAGATAAAATTGAGG - Intergenic
982821865 4:159950914-159950936 AGGCAGCTGAGAGCAAATTGAGG - Intergenic
986529455 5:8720680-8720702 GTGAGCCTGAGAACAAATTGTGG + Intergenic
993025136 5:82636872-82636894 GGGAGACTTACAGAAAGTTGAGG - Intergenic
993249471 5:85499821-85499843 TGAAGGCCTAGAGCAAAGTGAGG + Intergenic
998690296 5:144580478-144580500 TGGAGGCTTAGATAAAATGGTGG + Intergenic
1000374369 5:160565675-160565697 GGGAGGGTTAGAGCTCTTTGGGG + Exonic
1000512229 5:162197677-162197699 GGTAGGGTTAGAGAAAATGGTGG + Intergenic
1005093801 6:22088493-22088515 GGCAGGCTTAGAGCAGTGTGTGG + Intergenic
1007213244 6:40214927-40214949 GTGAAGCTGAGAGCAAATAGAGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010752090 6:79627132-79627154 GAGAAGCTTTGAGCAAGTTGAGG - Intergenic
1020493445 7:8818134-8818156 GGGAGGCTTAGGGCATAATTTGG + Intergenic
1022174531 7:27860846-27860868 GGGAGGCAAAGAGGAAAGTGGGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1025521253 7:61732494-61732516 GGGATACTTGGAGCAATTTGAGG - Intergenic
1025545515 7:62161191-62161213 GGGATACTTGGAGCAATTTGAGG - Intergenic
1026541267 7:71282009-71282031 GAGAGGCTTGGAGAACATTGAGG - Intronic
1033737637 7:144239124-144239146 GGGAGGCACAGAGCAGACTGGGG + Intergenic
1033745419 7:144311833-144311855 GGGAGGCACAGAGCAGACTGGGG - Intergenic
1037170103 8:15881106-15881128 AGATAGCTTAGAGCAAATTGTGG - Intergenic
1037749815 8:21674038-21674060 GGGAAGCTCAGAGCATAATGGGG - Intergenic
1040124683 8:43724049-43724071 GGGAGATTTGGAGCACATTGAGG + Intergenic
1041283284 8:56233370-56233392 GGGAGGATGAGAGGAAGTTGAGG - Intergenic
1044958122 8:97503130-97503152 GGGGGGCTTAGAAAAAGTTGAGG - Intergenic
1045009539 8:97945552-97945574 GGGAGACTTAGAACTAATTCAGG + Intronic
1048146217 8:131846458-131846480 GGGAGACTAAGAGCAACTTCAGG + Intergenic
1049263100 8:141650337-141650359 GGGAAAATTTGAGCAAATTGAGG + Intergenic
1050292966 9:4175898-4175920 GGGAGACTTGGACCAAATTGTGG - Intronic
1053314870 9:37042602-37042624 GTGTGGCTTCGAGCAACTTGAGG - Intergenic
1056737565 9:89222948-89222970 GGGAGTCTTAGGGAAAATGGGGG + Intergenic
1057341935 9:94210724-94210746 GGGAGGCTTAGTGGAAAATGGGG - Intergenic
1057595587 9:96413603-96413625 GGGAGCCTTGGAACAACTTGTGG + Intronic
1058596432 9:106620944-106620966 GGGAGGCTAAGGGCAAACTCTGG - Intergenic
1060153403 9:121302717-121302739 AGGACGCTTAGAGAAAAATGAGG + Intronic
1060641495 9:125242396-125242418 GGTAGGCTTTCAGCAAATAGTGG - Intergenic
1062479435 9:136744591-136744613 GGGAGGCTTGGGGCAAGTTCTGG - Intronic
1190286739 X:48966480-48966502 GGGAGGCTCACTACAAATTGTGG - Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1197299811 X:124764314-124764336 GTGAAGCTTAGAGCACACTGAGG + Intronic
1197988433 X:132292086-132292108 GGGAGAATTAGAGCATATTGAGG + Intergenic
1199969835 X:152851658-152851680 GAGAGGCTTAGAGCAGCATGAGG - Intronic
1200805032 Y:7424719-7424741 GGAAGGAATTGAGCAAATTGAGG + Intergenic