ID: 957368287

View in Genome Browser
Species Human (GRCh38)
Location 3:79255671-79255693
Sequence CACACACACATAATATTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 0, 2: 14, 3: 124, 4: 678}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957368286_957368287 7 Left 957368286 3:79255641-79255663 CCGTTCTGGAAGTATAGGTAAGC 0: 1
1: 0
2: 1
3: 1
4: 88
Right 957368287 3:79255671-79255693 CACACACACATAATATTTTGTGG 0: 1
1: 0
2: 14
3: 124
4: 678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957368287 Original CRISPR CACACACACATAATATTTTG TGG Intronic
901099206 1:6706357-6706379 CACACACACATCACATTGTATGG + Intergenic
901120100 1:6884325-6884347 CACACACACACAATTTTGTTTGG + Intronic
903927477 1:26840964-26840986 CACATACAGCTAATTTTTTGGGG + Intronic
905551802 1:38847449-38847471 CACACACACACACAATTTTAAGG + Intronic
905609963 1:39341877-39341899 CACACACACATACCAGTTTCAGG + Intronic
906173888 1:43752493-43752515 CAAACAAACAAAATATTGTGAGG - Intronic
906864766 1:49405754-49405776 CACACACCCATGATATTCAGAGG - Intronic
907615798 1:55925389-55925411 TACACACAGCTATTATTTTGGGG - Intergenic
908084237 1:60613363-60613385 CTCACACACTTAATTTTTGGGGG + Intergenic
908121564 1:60990870-60990892 CAAACACAAATGATACTTTGTGG + Intronic
908739858 1:67316412-67316434 CACACACACACACTACTCTGGGG - Intronic
908814710 1:68020041-68020063 CACATGAACAAAATATTTTGAGG + Intergenic
909404044 1:75266342-75266364 CACACACACACATTTATTTGTGG + Intronic
910029229 1:82696434-82696456 CACACAAAAACAAAATTTTGGGG - Intergenic
910285596 1:85550756-85550778 CACACACACACACCATTTAGAGG + Intronic
910484853 1:87701849-87701871 CACACACACATTATATATCATGG + Intergenic
910873346 1:91854611-91854633 CACACACTTATCATTTTTTGTGG - Intronic
910928005 1:92416137-92416159 CACACACACACACGGTTTTGGGG - Intergenic
911157311 1:94649311-94649333 GTCACACACATATAATTTTGTGG + Intergenic
911692768 1:100854167-100854189 CACGCACACACACTTTTTTGGGG + Intergenic
912692875 1:111818067-111818089 CACACACACACAGAATTATGAGG + Intronic
913587016 1:120285594-120285616 CACACACACACAAAATGTTTAGG + Intergenic
913621169 1:120612776-120612798 CACACACACACAAAATGTTTAGG - Intergenic
913939962 1:125092949-125092971 AACAGACACATCATAATTTGCGG + Intergenic
914155227 1:145081679-145081701 CACACACACAAAATCTAATGGGG + Intronic
914214167 1:145609129-145609151 CACACACACAAAATCTTTATTGG - Intronic
914466110 1:147929532-147929554 CACACACACAAAATCTTTATTGG - Intronic
914569030 1:148897479-148897501 CACACACACACAAAATGTTTAGG + Intronic
914603797 1:149232777-149232799 CACACACACACAAAATGTTTAGG - Intergenic
914845166 1:151279810-151279832 CATATACACATAATATTTTGGGG - Intergenic
915159364 1:153906107-153906129 CACACACACAAAACAGTGTGGGG + Intronic
915381856 1:155448918-155448940 CACACACACATAGAAATTTGTGG - Intronic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
916547596 1:165821022-165821044 CACACACAAATAGAATGTTGAGG - Intronic
916945627 1:169724155-169724177 CACAGAAACACAATATTTTGTGG - Exonic
917118372 1:171624596-171624618 CACACACACAAAATATTAGCCGG - Intergenic
917634211 1:176919090-176919112 CCAACACTCATAATATTTTGTGG + Intronic
918306163 1:183248882-183248904 CACACACACACACTCTTTTAGGG - Exonic
918364380 1:183790933-183790955 CACACACACACAATCTCTGGAGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918475115 1:184916528-184916550 CACACACACATAATTATTCAAGG - Intronic
918975478 1:191479436-191479458 CACACATACATCATATTTTGTGG - Intergenic
919169149 1:193931654-193931676 CTGAGACACATAATATTTTAAGG + Intergenic
919300749 1:195762298-195762320 CACATACACATAATTAATTGTGG - Intergenic
919370217 1:196714585-196714607 CACACACACATATTACTGAGTGG - Intronic
919710120 1:200718168-200718190 CACACACACATCAAAACTTGTGG + Intergenic
921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG + Intergenic
921534444 1:216328790-216328812 CACAGACACATACTCTTTTTAGG - Intronic
921547692 1:216491655-216491677 CACACACACATAAGTATGTGAGG + Intergenic
921672091 1:217936801-217936823 CACATACATATAATTTTTTGTGG - Intergenic
921976128 1:221205416-221205438 CACACACACACAATGACTTGAGG + Intergenic
923332419 1:232937448-232937470 CACACAAACACATTATGTTGTGG - Intergenic
923333029 1:232943284-232943306 CACTCACACATACTGTGTTGTGG - Intergenic
923353387 1:233130455-233130477 CACACACACACAAAAGTTGGGGG - Intronic
923650505 1:235868618-235868640 TACAAACAAATAATACTTTGAGG - Intronic
923975394 1:239256418-239256440 AACATACACCTAATAGTTTGAGG - Intergenic
924069491 1:240261759-240261781 CACACACAGGTAATTATTTGGGG - Intronic
924481823 1:244442258-244442280 CACACACACACAAATTTTTTAGG + Intronic
924509419 1:244716704-244716726 CACACACACACAATCAATTGTGG - Intergenic
1063189517 10:3680150-3680172 CACATACAGTTGATATTTTGAGG - Intergenic
1063872730 10:10436457-10436479 CAAATACACATAATAAATTGGGG + Intergenic
1064146624 10:12830954-12830976 CACACACACACAATGTTATTAGG + Exonic
1064186188 10:13163677-13163699 CACACACACACAAATTATTGGGG - Intronic
1064737627 10:18399018-18399040 CACCCACACATAATTTTGTGCGG - Intronic
1065267068 10:23987589-23987611 CACACACAAATAAGAATGTGAGG - Intronic
1066054766 10:31670553-31670575 CACACACACACACTATTGTTAGG + Intergenic
1066452740 10:35546010-35546032 CTCATAAACATACTATTTTGAGG - Intronic
1066780185 10:38936856-38936878 AACAGACACATTATAATTTGCGG - Intergenic
1067976599 10:51032764-51032786 AACAAACAAATATTATTTTGGGG + Intronic
1067984281 10:51124351-51124373 CCCACACACATAGTATTTCAGGG - Intronic
1068350132 10:55832629-55832651 CACACACACACAAAATTTAAAGG - Intergenic
1068449981 10:57173811-57173833 CACACACAAAAAATGTGTTGAGG - Intergenic
1068718324 10:60213203-60213225 CACACACACAAACAACTTTGTGG + Intronic
1068761471 10:60715408-60715430 CAGACACACATAATATCTGGTGG + Intronic
1068972227 10:62971883-62971905 CACACACACACAATGTTTGAAGG + Intergenic
1068985956 10:63107826-63107848 CACTAACACACAATCTTTTGAGG - Intergenic
1069126853 10:64645696-64645718 AAAACACACATAATAATTTTAGG - Intergenic
1069411607 10:68159953-68159975 CTCACACACATCATTTTTTGTGG + Intronic
1069438783 10:68409013-68409035 CACACACACACAATAGTTTAGGG - Intergenic
1069746674 10:70719401-70719423 CACACACACACACTTTTTAGAGG + Intronic
1069754057 10:70762434-70762456 AACACACACACAACCTTTTGGGG - Exonic
1070071183 10:73091246-73091268 CACACACAAGTAACATTTTGAGG + Intronic
1071115422 10:82213485-82213507 TACACATACATAATATCTTGAGG - Intronic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1071543122 10:86506253-86506275 CAAACAAACAAAATACTTTGAGG + Intronic
1071775729 10:88785995-88786017 CTCACATACATCAAATTTTGAGG + Intergenic
1072070554 10:91911730-91911752 CATATACACACAAAATTTTGTGG - Intergenic
1072271155 10:93778428-93778450 CATACACACAGATTATTTTAAGG + Intronic
1072285606 10:93911563-93911585 AAAACACACATTAGATTTTGAGG - Intronic
1072492696 10:95923241-95923263 CACACACACACACAAATTTGGGG - Intronic
1073408102 10:103315954-103315976 CACACACATATAAGCTGTTGAGG - Intronic
1073911243 10:108347316-108347338 CACAAACACTTCATATTTTCTGG - Intergenic
1074295767 10:112186885-112186907 CAAACAAAAACAATATTTTGTGG + Intronic
1074297034 10:112199546-112199568 CTCACATACTTAATTTTTTGTGG - Intronic
1074696899 10:116057980-116058002 CACACACACACAATGATTGGAGG - Intronic
1074846479 10:117403376-117403398 CCCACCCCCATAATCTTTTGAGG - Intergenic
1077638826 11:3862891-3862913 CACACACACATATTTTTTTGAGG + Intronic
1077731895 11:4740381-4740403 TACAAAGAAATAATATTTTGGGG + Intronic
1077944999 11:6887588-6887610 CACACACACATATTAAGTTCTGG + Intergenic
1077996551 11:7457364-7457386 CACACACAGATAATATCAAGTGG - Intronic
1078370175 11:10737736-10737758 CACACACACACGTTTTTTTGTGG + Intergenic
1079623712 11:22589427-22589449 CACACACACACAATATCTAGTGG - Intergenic
1079778472 11:24565034-24565056 CAAACAAAAATAGTATTTTGTGG - Intronic
1079982432 11:27165391-27165413 TACACACACTTAAGATTCTGTGG + Intergenic
1080780923 11:35429402-35429424 CACACTCACCTAAGACTTTGAGG - Intergenic
1082611585 11:55305360-55305382 CTCACATTAATAATATTTTGAGG - Intergenic
1082889412 11:58122596-58122618 TACTTAAACATAATATTTTGGGG + Intronic
1083055706 11:59817265-59817287 CACACACACACAGTTTTTTGAGG - Intergenic
1083532196 11:63433978-63434000 CACACACACAAAAAAATTTCAGG + Intergenic
1083640701 11:64143791-64143813 CACACACACACAATTTCCTGGGG + Intronic
1084285104 11:68125947-68125969 CACACACACACAATCTTTAGAGG + Intergenic
1084488721 11:69466009-69466031 CCCACCCACATTATTTTTTGAGG - Intergenic
1085229672 11:74954726-74954748 CACACATACTTTTTATTTTGAGG - Intronic
1085933578 11:81116725-81116747 TACACATATATAATATTTTATGG - Intergenic
1086160967 11:83721373-83721395 CACTCATACTTAATATATTGTGG - Intronic
1086526100 11:87727718-87727740 CACACACATAGAATGTTTTAAGG - Intergenic
1088145620 11:106672747-106672769 CACACACACATATATTTATGTGG + Intergenic
1088993663 11:114977370-114977392 CACACACACACAATATTATAGGG - Intergenic
1089398481 11:118151141-118151163 CACACACACACATCATTTTCAGG + Intronic
1089508949 11:118983527-118983549 CACACACACACAATAATTCCAGG - Intergenic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1090126462 11:124090416-124090438 CACACACACACACAATATTGGGG + Intergenic
1090529463 11:127575848-127575870 CACTCACACATTCTCTTTTGGGG + Intergenic
1090533372 11:127614447-127614469 TACACACACATAAAAATGTGGGG - Intergenic
1091001616 11:131914518-131914540 CTCACCAACATCATATTTTGAGG + Intronic
1091276745 11:134357898-134357920 CACACACACTTAACATTTCCTGG - Intronic
1091848453 12:3676281-3676303 CACACACACAGCATGTTGTGGGG + Intronic
1091876166 12:3934820-3934842 CACACACACAAAATAGACTGGGG + Intergenic
1093452793 12:19334883-19334905 CACACACACAAAATATTAGCCGG + Intronic
1093701548 12:22227594-22227616 CACACAAAAAAAATGTTTTGAGG + Intronic
1093739582 12:22668160-22668182 CACATACACATAAAATTTTAGGG + Intronic
1094029129 12:25990920-25990942 CACACACAGAAAACATTTTGGGG + Intronic
1094096632 12:26712662-26712684 CACACACACACACAATTTTGTGG + Intronic
1094354397 12:29562809-29562831 TACATACATTTAATATTTTGGGG + Intronic
1095328326 12:40925519-40925541 CACACACACACAATTTCATGTGG - Intronic
1096469126 12:51865191-51865213 CACACACACACAATAGTCAGAGG + Intergenic
1096855219 12:54476534-54476556 CACACACACACAACATTTAGAGG - Intergenic
1097191909 12:57223518-57223540 CACACACACACAACCATTTGGGG + Intronic
1097463069 12:59888090-59888112 CACGCACACACATTATTCTGTGG - Intergenic
1097636089 12:62123803-62123825 CACACACACACCACCTTTTGAGG + Intronic
1097698416 12:62796774-62796796 CACACACACACAAATTATTGGGG + Intronic
1098835958 12:75424707-75424729 CACAAAAACATAATATATTTGGG - Intronic
1098877780 12:75884471-75884493 CATACACACATAATGCTATGTGG - Intergenic
1098926273 12:76352809-76352831 CATATACACACAAAATTTTGTGG - Exonic
1099926450 12:89024440-89024462 CACACACACATATTATTCAAGGG + Intergenic
1100317924 12:93462534-93462556 CACACAAACACATTATTTTTAGG - Intergenic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100752745 12:97717103-97717125 CACACAAACAAAAGCTTTTGGGG - Intergenic
1101147741 12:101857045-101857067 CATACTCACATATTATTTAGTGG - Intergenic
1101184843 12:102265040-102265062 CACACACACACAATCTTCAGTGG + Intergenic
1101257245 12:102990559-102990581 GAAACACACAAAACATTTTGAGG - Intergenic
1101571868 12:105961069-105961091 CACTCACACAGAATAATGTGGGG + Intergenic
1101951394 12:109178919-109178941 CTCACAGACATAATATTCTGTGG - Intronic
1102112579 12:110375768-110375790 CACACACACATATTTTTATAGGG - Intronic
1103885023 12:124193949-124193971 CACAATCACCTAATATTTTCAGG - Intronic
1104124094 12:125828778-125828800 CACACACACACACTCATTTGTGG - Intergenic
1104132064 12:125903713-125903735 CACACACACAGAATAATGTTTGG - Intergenic
1104194249 12:126516894-126516916 CACACACACATAACTATGTGAGG - Intergenic
1104406983 12:128526112-128526134 CACACACTCAAAATATTTGTTGG - Intronic
1105725922 13:23161855-23161877 CAGACAGACACAATATTTAGTGG + Intergenic
1105846196 13:24296318-24296340 CAGTCACACACAATATTTTTTGG - Intronic
1106539748 13:30679764-30679786 CACACACACATCCCATATTGGGG - Intergenic
1106703364 13:32253824-32253846 TACACATAAATAATATTTTAAGG - Intronic
1107237231 13:38186498-38186520 CACACACAGATAAGCTTTAGAGG + Intergenic
1107377898 13:39824116-39824138 CACTCACAAATACTATTTCGGGG - Intergenic
1107605776 13:42054748-42054770 CTCACATACTTAATTTTTTGTGG - Intronic
1107680055 13:42838840-42838862 CACAAACAGATAAGGTTTTGGGG + Intergenic
1107727226 13:43311064-43311086 CACACACAGGTGATACTTTGGGG + Intronic
1107882704 13:44846519-44846541 CACACACACACACTTTTTTTAGG + Intergenic
1107923662 13:45236518-45236540 CACACACACACAAGTTTATGAGG + Intronic
1108122670 13:47207026-47207048 CACACACATATATTGGTTTGGGG + Intergenic
1108234376 13:48387802-48387824 CACACAAACAAAAGCTTTTGGGG + Intronic
1108266658 13:48716484-48716506 TAAAAACACATCATATTTTGGGG + Intergenic
1108803074 13:54123313-54123335 CACACACACACACTACTTTTTGG - Intergenic
1108895727 13:55325325-55325347 CACACACACAAACTAATTTATGG - Intergenic
1108982899 13:56541538-56541560 CACACACACATTTTTTTTTCAGG - Intergenic
1109687970 13:65845004-65845026 CACACACACATAATACATTTAGG + Intergenic
1109983740 13:69947005-69947027 CACACACACACAATTTTGTATGG - Intronic
1110142228 13:72144491-72144513 CACACACAAATAAAAGTGTGAGG + Intergenic
1110370447 13:74734028-74734050 CACACACACAGACCATTTGGTGG - Intergenic
1110490035 13:76092341-76092363 CACACACACACAAAGTGTTGGGG + Intergenic
1110932127 13:81233621-81233643 CACACACACACAAAATTATCCGG + Intergenic
1111014477 13:82360212-82360234 CACACACACATAGTATATTTTGG - Intergenic
1111133925 13:84013871-84013893 CACACACACATACTGTTGTGGGG + Intergenic
1111236275 13:85412539-85412561 CACACACACATATTACTTCCTGG + Intergenic
1111473233 13:88713527-88713549 CACACACACATAAATTATTTGGG - Intergenic
1111566972 13:90028887-90028909 CAAACACACAAAAAGTTTTGTGG - Intergenic
1111935530 13:94553369-94553391 CACACACACACACATTTTTGGGG + Intergenic
1112152981 13:96784450-96784472 CACACACACATAGGATGTTGTGG + Intronic
1114934667 14:27518432-27518454 CACACACACAAAAAATTAGGTGG - Intergenic
1115031372 14:28799086-28799108 CACACACACATAATCATATACGG + Intronic
1115180339 14:30618492-30618514 CACACACACATACTTTGTTGGGG + Exonic
1116086660 14:40248185-40248207 TACACACACACAATACTTTGAGG + Intergenic
1116231416 14:42222802-42222824 CACACACACGCAATATGTGGAGG - Intergenic
1116578656 14:46609207-46609229 CACACACACACAAAATCTTCAGG + Intergenic
1116758229 14:48976546-48976568 CACACACACACGACATTTCGGGG + Intergenic
1116793432 14:49364174-49364196 CACACACACAAAATCTGCTGTGG - Intergenic
1116980237 14:51161428-51161450 CAAAAACACATCTTATTTTGGGG + Intergenic
1117210163 14:53489224-53489246 CACACACACAGAGTAATATGAGG + Intergenic
1117398559 14:55336889-55336911 CACACATATATACTATTTTATGG + Intronic
1118034913 14:61856431-61856453 AATACATACATACTATTTTGAGG + Intergenic
1118499084 14:66340622-66340644 CACACACACATATAATTGTTTGG - Intergenic
1118564802 14:67127907-67127929 TACATACACATACCATTTTGAGG - Intronic
1120036974 14:79708955-79708977 CACACACACATAATAAGATGGGG - Intronic
1120574423 14:86163763-86163785 CACACACACACAACCTTATGTGG - Intergenic
1120754914 14:88233708-88233730 CTCAGTCACATAATATTATGTGG + Intronic
1121421279 14:93817146-93817168 CACACACACATAAGCATATGTGG - Intergenic
1121552697 14:94814284-94814306 CCCACCCACATATTATTTTGGGG - Intergenic
1122033346 14:98929542-98929564 CACAAACACATCCTATGTTGAGG + Intergenic
1122749806 14:103924474-103924496 CACACACACACAATGTTTTTTGG + Intronic
1123123931 14:105930959-105930981 CTCACACACTTATCATTTTGTGG - Intronic
1123162121 14:106288429-106288451 CACACAAAAATAAAAATTTGAGG - Intergenic
1202937061 14_KI270725v1_random:99246-99268 AACAGACACATAGTAATTTGCGG + Intergenic
1123396138 15:19938497-19938519 AACAGACACAGAATAATTTGCGG - Intergenic
1125163806 15:36679154-36679176 CACACATACACACTCTTTTGTGG - Intronic
1126906045 15:53367009-53367031 CACACACACATTATTGGTTGTGG + Intergenic
1127183103 15:56446132-56446154 CACACACACACACTCTTATGGGG - Intronic
1127564575 15:60174315-60174337 CACATACACACAAAATTTGGGGG + Intergenic
1127672333 15:61207161-61207183 CACACACACATACTACTTGTTGG + Intronic
1127857504 15:62964534-62964556 CACACACACATAAAAGAATGGGG - Intergenic
1127999643 15:64178778-64178800 CACACACACACAAAAGTTTTTGG - Intronic
1128430607 15:67589759-67589781 CACACACACACATTTTTTTCTGG - Intronic
1128661408 15:69503784-69503806 CACACACACACAAAATCTTTAGG + Intergenic
1128907687 15:71482740-71482762 CACACACGGCTAATATTTTGTGG + Intronic
1130086578 15:80782601-80782623 CACACACACACACTTTTGTGGGG - Intronic
1130088576 15:80800009-80800031 CACACACACATAAAATTAGCTGG - Intronic
1131195772 15:90353418-90353440 CACACACACACACACTTTTGGGG - Intronic
1131957257 15:97749547-97749569 CACACACACACAACATTTTGAGG + Intergenic
1132031522 15:98441919-98441941 CACACACACATATGGATTTGGGG - Intronic
1132081234 15:98867587-98867609 TACACACAGATAATAATTAGAGG - Intronic
1133475477 16:6117216-6117238 TACACACTCATAGTAATTTGTGG - Intronic
1133694696 16:8250820-8250842 CACACACAATGAATATTTAGAGG + Intergenic
1134741680 16:16552965-16552987 AACACACACATAAAATCTTCAGG - Intergenic
1134925884 16:18159473-18159495 AACACACACATAAAATCTTCAGG + Intergenic
1135166342 16:20142477-20142499 CACACACACACAATTTTTTGTGG + Intergenic
1136099386 16:27982414-27982436 CACACACACATCATATTGGCAGG - Intronic
1136698610 16:32110649-32110671 AACAGACACATAATAATTTGCGG - Intergenic
1136768998 16:32817182-32817204 AACAGACACATAATAATTTGTGG + Intergenic
1136799111 16:33053943-33053965 AACAGACACATAATAATTTGCGG - Intergenic
1136901602 16:34045144-34045166 AACAGACACATAATAATTTTTGG - Intergenic
1136956796 16:34796896-34796918 AACAGACACATAATAATTTGCGG - Intergenic
1137330238 16:47487347-47487369 CTCACAGACATAATATTTTAAGG - Intronic
1137381645 16:48004769-48004791 CACAAATTCAAAATATTTTGAGG - Intergenic
1138356423 16:56384729-56384751 CACACACACTCAATTTTTGGAGG + Intronic
1138385066 16:56631006-56631028 CACACACACACATTAATTTGGGG - Intergenic
1138463575 16:57169845-57169867 AACGAACACATATTATTTTGGGG + Intronic
1138958204 16:61996983-61997005 CACATACACACAATATTCTGTGG - Intronic
1139057868 16:63208087-63208109 CACACACACACACAATTTTGAGG + Intergenic
1139218674 16:65156227-65156249 CACACACACACAATTTTTCCTGG - Intergenic
1139253960 16:65522824-65522846 GACCCACACATTGTATTTTGAGG + Intergenic
1139745466 16:69070653-69070675 AACACACACAAAAGATCTTGGGG + Intronic
1140309311 16:73833850-73833872 CACACACACATCATACAATGTGG - Intergenic
1140440123 16:74981395-74981417 CACACACACACAAAATTGTGGGG + Intronic
1140898117 16:79343244-79343266 CACACACATAGATTTTTTTGGGG - Intergenic
1141289316 16:82703220-82703242 CACACACACACAATGTTATAAGG + Intronic
1141332266 16:83121983-83122005 CACACACACACACTTTTATGGGG + Intronic
1141373775 16:83511159-83511181 CACACACACAGAATGGTTCGTGG + Intronic
1203071413 16_KI270728v1_random:1079289-1079311 AACAGACACATAATAATTTGTGG + Intergenic
1144900400 17:18582508-18582530 CACACACACATATACATTTGGGG - Intergenic
1145692762 17:26760907-26760929 AACAGACACATAATAATTTGCGG - Intergenic
1145709499 17:26957549-26957571 AACAGATACATAATAATTTGTGG - Intergenic
1147730475 17:42597485-42597507 CACACACACAAAATAGATTCTGG - Intronic
1148713099 17:49696252-49696274 CACACACACACAATGTTTTCGGG + Intergenic
1149019463 17:51946305-51946327 CTCACACACTTATTTTTTTGTGG - Intronic
1149205395 17:54238514-54238536 CACACACACACACGAATTTGTGG - Intergenic
1149241525 17:54656160-54656182 TACAAGCACATAATATTTTATGG + Intergenic
1150880246 17:69016842-69016864 CACACACACACGTTATTTTAAGG - Intronic
1151099801 17:71543810-71543832 CACAAACAAATAAAATGTTGGGG + Intergenic
1151373957 17:73670567-73670589 CACACACACACAAAAATTAGAGG + Intergenic
1153327853 18:3840079-3840101 GGCACACATATAATATTTAGAGG + Intronic
1154027278 18:10720351-10720373 CACACACACAGAATATATATAGG - Intronic
1154458655 18:14556265-14556287 CACACACACATATTATGTTTTGG - Intergenic
1154518762 18:15203208-15203230 AACAGACACATAATAATTTGCGG + Intergenic
1155086286 18:22462134-22462156 AAGACACACTTAAAATTTTGGGG - Intergenic
1155822292 18:30392791-30392813 TACACACACATAGTATATTAGGG - Intergenic
1156076840 18:33288812-33288834 CAAACAGACATTATATTATGAGG + Intronic
1156310230 18:35915527-35915549 CACACACACACAAGAATGTGTGG + Intergenic
1156417596 18:36913557-36913579 CACACACACACACTACTTAGAGG + Intronic
1156607667 18:38686707-38686729 CACACCCACATAATGTTTGGAGG + Intergenic
1156616339 18:38789656-38789678 CACACACAGAAAATATTTCTTGG - Intergenic
1156792010 18:40987122-40987144 CACACACACAAGATAATTTTGGG + Intergenic
1158032904 18:52988793-52988815 CACACACATGTAATTTTTTGTGG + Intronic
1158036303 18:53035146-53035168 CACACACAGATAAATGTTTGAGG - Intronic
1158302929 18:56072847-56072869 CACACACACACAATATGTTGGGG + Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1159060120 18:63505960-63505982 CCCACACAAATAATCTTTTAAGG - Intergenic
1159186425 18:64981757-64981779 CACACACACAGAATAAATCGTGG + Intergenic
1159332442 18:67015307-67015329 CAAACACATATAAGGTTTTGAGG - Intergenic
1159393005 18:67819134-67819156 TTCCCCCACATAATATTTTGGGG - Intergenic
1159701381 18:71632281-71632303 CACACACACACAATATAAAGAGG + Intergenic
1159701404 18:71632559-71632581 CACACACACACAATATAAAGAGG + Intergenic
1159728915 18:72000538-72000560 CACACACACATATAGTTTTTGGG + Intergenic
1159777908 18:72624746-72624768 CACACACACATAATTATGTAAGG - Intronic
1160097730 18:75890522-75890544 GACACACACAGGATATTTGGGGG + Intergenic
1160278721 18:77465707-77465729 TACACACACACAATATTTTCAGG - Intergenic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1161899545 19:7108217-7108239 AAGACAAATATAATATTTTGGGG + Intergenic
1162297062 19:9820516-9820538 CACACACACATTTTTTTTTTTGG - Intronic
1162436387 19:10662253-10662275 ACCACAAACATAATGTTTTGTGG + Intronic
1162582073 19:11537652-11537674 CACACACTAATGATATGTTGAGG - Intergenic
1163760048 19:19131519-19131541 CACACACACACACAATTTTTTGG + Intronic
1163760050 19:19131521-19131543 CACACACACACAATTTTTTGGGG + Intronic
1163962023 19:20705490-20705512 CACACACATATAGAATTATGTGG - Intronic
1164840961 19:31391721-31391743 CACACACACACACGTTTTTGTGG + Intergenic
1165210062 19:34227780-34227802 CACACACACACAACCTTCTGTGG - Exonic
1165290050 19:34875999-34876021 CACACTCACATACTCTTGTGGGG + Intergenic
1165292844 19:34903249-34903271 CACACACACCTTATATTATTGGG - Intergenic
1165695311 19:37896208-37896230 CATACACACGGCATATTTTGAGG + Intronic
1166319921 19:42011136-42011158 CACACACCCCTAATGTATTGTGG + Intronic
1166699396 19:44873650-44873672 CACACACACATTATTTGTAGTGG + Intronic
1166757911 19:45205156-45205178 CACACACACACAATTTCTTGTGG - Intronic
1166890034 19:45985624-45985646 TACACACACACATTAGTTTGTGG - Intergenic
1202682763 1_KI270712v1_random:23824-23846 AACAGACACATAATAACTTGCGG - Intergenic
924981628 2:227879-227901 CACACACACACATAATTTTATGG - Intronic
925542089 2:4977090-4977112 TACAGACACATAGTATATTGTGG - Intergenic
926031477 2:9593931-9593953 CACACACACACACTTTTTTAAGG + Intronic
926209454 2:10858683-10858705 CACACACACACAACATTGTTGGG + Intergenic
926477695 2:13348103-13348125 CACACATACATGATATATGGAGG + Intergenic
926802113 2:16667491-16667513 CACACACCCCTAAAATTTTCTGG + Intergenic
926862972 2:17328236-17328258 CACACACACACTTTGTTTTGGGG + Intergenic
927149721 2:20188652-20188674 CACACACACACACGATTCTGCGG + Intergenic
928966749 2:36983569-36983591 CACACCCAGCTAATATTTTTGGG - Intronic
929147699 2:38721122-38721144 CACACCCACATTCTATTATGAGG - Intronic
929169217 2:38914725-38914747 CACTCTCACATAATACATTGTGG - Intronic
930300062 2:49604164-49604186 CACACACACACAGTTTTTTCAGG + Intergenic
930426621 2:51221016-51221038 CACACACACATCCTATTCTGTGG + Intergenic
930487927 2:52031582-52031604 CACACACAAACAATATTTAAAGG + Intergenic
930656593 2:54013243-54013265 CACACACACATATTAGATGGTGG - Intronic
930793846 2:55366568-55366590 CACACACACAAGATATGATGTGG + Intronic
931295254 2:60917670-60917692 CACACACACACAGTATTTTGGGG - Intronic
931895803 2:66728159-66728181 CACACACACACAATGATTAGGGG - Intergenic
932504802 2:72218412-72218434 CACACACACATATTATGTTCTGG - Intronic
932839655 2:75070203-75070225 CACACATACATACAATGTTGGGG - Intronic
933026005 2:77260365-77260387 CACACACACACACGATTTTTTGG - Intronic
933400750 2:81793919-81793941 TTCACAGACATAAAATTTTGAGG - Intergenic
933506906 2:83188257-83188279 CACACACACATACTTTTTTAAGG - Intergenic
933558209 2:83858253-83858275 CACACACACACACTTTTTTTGGG - Intergenic
934249038 2:90331351-90331373 AACAGACACATAATAACTTGCGG + Intergenic
934260539 2:91472123-91472145 AACAGACACATAATAACTTGCGG - Intergenic
934868274 2:97833962-97833984 CACAAAAAAATAATATTTGGGGG - Intronic
935402630 2:102676121-102676143 CACATACACAGAATACTTTGTGG - Intronic
935859901 2:107318245-107318267 TGCATATACATAATATTTTGAGG - Intergenic
936850244 2:116887734-116887756 CACACACACACTGTATTTTGGGG - Intergenic
938399403 2:130976323-130976345 CACACACACACACGATTCTGGGG - Intronic
938518764 2:132043709-132043731 AACAGACACATAATAATTTGAGG + Intergenic
938736876 2:134193665-134193687 CACACACACACAAAGATTTGGGG - Intronic
939203356 2:139067909-139067931 CACACACACATATTAAAATGTGG + Intergenic
939275718 2:139993538-139993560 CACTCACAGATAATATTTCTTGG - Intergenic
939499948 2:142971298-142971320 CACACACACACATAATGTTGTGG - Intronic
940072759 2:149707834-149707856 CACACATATGTAATATTTTTAGG - Intergenic
940334138 2:152507273-152507295 CACACAGACATAAAAATTTCTGG - Intronic
940501268 2:154496312-154496334 CACACACACAAAATATAATCTGG - Intergenic
940598939 2:155832760-155832782 CACACACACACAATAATTCTGGG + Intergenic
940612567 2:156008151-156008173 CACAAACACAACATATTTTGGGG + Intergenic
941579242 2:167274115-167274137 CACACACACACAAAAATTAGCGG - Intergenic
941890437 2:170575536-170575558 AAAACACTAATAATATTTTGTGG - Intronic
941890941 2:170580702-170580724 CACACATATATAAGGTTTTGTGG - Intronic
942122579 2:172792843-172792865 CACTTACACAGAATCTTTTGTGG + Intronic
943246310 2:185455834-185455856 CACAGACACATTGTAATTTGAGG - Intergenic
943877943 2:193097916-193097938 CTCACATACTTAACATTTTGTGG + Intergenic
943916320 2:193638059-193638081 CACACACACATAATGTATTATGG + Intergenic
944258950 2:197655416-197655438 CACACACACATAAAAGTTTCAGG + Intronic
944315294 2:198278230-198278252 CACACACACTTAAAAGTTTGAGG + Intronic
944348234 2:198694731-198694753 CACACACACATCATATTCATGGG + Intergenic
944371746 2:198992181-198992203 AACACACACATTGTAGTTTGAGG - Intergenic
944684031 2:202102193-202102215 CACACACACACACTTTTTGGGGG + Intronic
944813014 2:203346326-203346348 CAAACAAACATAGTCTTTTGTGG - Intronic
945317753 2:208389257-208389279 CACACACACACAATCTATTGAGG + Intronic
945519099 2:210800993-210801015 CACACAAACATAATATTACGTGG + Intergenic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
946645809 2:221832552-221832574 AGCAAACACATAATATCTTGAGG - Intergenic
947952878 2:234163173-234163195 CACACACACACCATCTTTTTTGG - Intergenic
947971089 2:234325729-234325751 CACACACACACAAAATTTTGTGG + Intergenic
948724443 2:239923585-239923607 AACACACACATCAAAATTTGTGG + Intronic
948819578 2:240533744-240533766 CACACACACACACTTTTTTTAGG + Intronic
1169820010 20:9700039-9700061 CACACATACATACATTTTTGGGG + Intronic
1169907801 20:10620853-10620875 CAAAAACAAAGAATATTTTGTGG - Intronic
1169977613 20:11347743-11347765 CACACACACAAAAAAAATTGAGG - Intergenic
1170811175 20:19675881-19675903 CACACACAGACAGTAGTTTGAGG - Intronic
1171153082 20:22844813-22844835 TACACACAGAAAGTATTTTGGGG + Intergenic
1171477831 20:25427142-25427164 CACCAACACTAAATATTTTGGGG + Intronic
1172370403 20:34385177-34385199 CACACACACATAAAATTAGCTGG - Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1172981096 20:38942340-38942362 AACTCACACATAAATTTTTGTGG - Intronic
1173495684 20:43515529-43515551 GACTCACTCATCATATTTTGGGG + Intronic
1173985170 20:47255839-47255861 CACACACACACCATATACTGAGG + Intronic
1174470906 20:50759871-50759893 CACACTCAGCTAATATTTTTCGG + Intergenic
1174502317 20:50994608-50994630 CCCACTCACATAATAGTATGTGG + Intergenic
1176518843 21:7809406-7809428 CACACACACATAATATAAACAGG - Intergenic
1176586252 21:8589730-8589752 AACAGACACATAGTAATTTGCGG - Intergenic
1176705476 21:10116359-10116381 CTCACAAACATAATATTTAGTGG - Intergenic
1176742956 21:10622450-10622472 AACAGACACATAGTAATTTGAGG - Intergenic
1176815494 21:13597076-13597098 CACACACACATATTATGTTTTGG + Intergenic
1176911452 21:14570052-14570074 TTCACACAGAAAATATTTTGTGG + Intronic
1176957692 21:15125247-15125269 CATACACACAAAATAATTAGTGG + Intergenic
1177183063 21:17764364-17764386 CAAACACATATTATATTTTCTGG + Intergenic
1177447259 21:21213844-21213866 AACATACACATAGTATTTAGGGG + Intronic
1177492604 21:21847119-21847141 CTCACATACACATTATTTTGAGG + Intergenic
1177925112 21:27204387-27204409 CACACACACACATTAGTTTGTGG - Intergenic
1178130851 21:29571194-29571216 CACACACACAAAATATTAACTGG + Intronic
1178624964 21:34207740-34207762 CACACACACGCAATATTTAGGGG + Intergenic
1178652871 21:34439419-34439441 CACACACACATAATATAAACAGG - Intergenic
1178751214 21:35305120-35305142 CACACACACACAAATTTTGGAGG - Intronic
1178846656 21:36179723-36179745 CACACACACACAAGATTGAGTGG - Intronic
1178909027 21:36659440-36659462 CACACACACACAATATTAGCTGG - Intergenic
1179934802 21:44595728-44595750 CACATACACATAATAGAATGAGG - Intronic
1180269058 22:10566634-10566656 AACAGACACATAGTAATTTGCGG - Intergenic
1180280889 22:10693861-10693883 AACAGACACATAATAATTTGCGG - Intergenic
1180567937 22:16691156-16691178 CACACACACATGCTTTTTTTGGG - Intergenic
1181309369 22:21936014-21936036 CACACACAGCTAATTTTTTTTGG - Intronic
1182119515 22:27777712-27777734 CACACACACAAAATATTAGCTGG + Intronic
1182664691 22:31949079-31949101 CACACACACATAAAACGTTAGGG - Intronic
1182798812 22:33013535-33013557 CTCACACACATCATTTTCTGTGG + Intronic
1183626842 22:39009175-39009197 CACACACACAAAATAGCTGGGGG - Intergenic
1184981354 22:48097813-48097835 CACACACACACAATTGTGTGTGG - Intergenic
1185105157 22:48864622-48864644 CACACACACACGATACTTTCAGG - Intergenic
1185294860 22:50048106-50048128 CACACACACACACTTTTTTGGGG - Intronic
1203289672 22_KI270735v1_random:23001-23023 AACAGACACATAATAATTTGCGG + Intergenic
1203324053 22_KI270737v1_random:100198-100220 CACAAACTCATCATTTTTTGTGG + Intergenic
949219092 3:1608030-1608052 CACACACACAAAATATTAGGTGG - Intergenic
949359615 3:3217793-3217815 CACACACACATTTTAAATTGTGG + Intergenic
949383967 3:3479236-3479258 CACAGACAAATAATTTTTTGAGG + Intergenic
949755630 3:7407363-7407385 CCCACATACATATTGTTTTGAGG - Intronic
949956436 3:9272904-9272926 CACTAACACTTATTATTTTGGGG + Intronic
950627008 3:14254595-14254617 CACACACACACAAGATATTAGGG - Intergenic
951161497 3:19428298-19428320 CACAGACTCAGAATATTTTCTGG - Intronic
951402836 3:22255416-22255438 TACACACACTTAACATTTTGGGG + Intronic
951418187 3:22450461-22450483 CACACACACATTTTATTAAGTGG + Intergenic
952156424 3:30648451-30648473 CACACACACACAAAACTGTGGGG + Intronic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
952471236 3:33654297-33654319 CACACACACACAGGATTTTGTGG + Intronic
952508228 3:34027315-34027337 CCCACACACACAAAATTTAGTGG - Intergenic
952644049 3:35635069-35635091 CACACACACACACCATTTTAAGG + Intergenic
952698619 3:36301595-36301617 CACACACACATGATAACTTTTGG - Intergenic
952868599 3:37876389-37876411 CCACCACAGATAATATTTTGGGG - Intronic
952955531 3:38555181-38555203 CACACACACACACAATTTTTTGG + Intronic
955039002 3:55296718-55296740 CACACACACATCCTATTTTGTGG - Intergenic
955170203 3:56556833-56556855 CACACACACACACCTTTTTGGGG - Intergenic
955562509 3:60206975-60206997 CACACACATATATCCTTTTGAGG - Intronic
955963059 3:64360713-64360735 CACACACACAAAAATTTTTCGGG - Intronic
956047547 3:65212251-65212273 TACACACACATAAAAATTAGCGG + Intergenic
956713710 3:72060305-72060327 CACACACAGCTAATATCTGGTGG + Intergenic
956956379 3:74345696-74345718 GACACACACATAACATTTCTTGG + Intronic
957252215 3:77787592-77787614 CATACACACATAATATATTTGGG - Intergenic
957368287 3:79255671-79255693 CACACACACATAATATTTTGTGG + Intronic
957523487 3:81350908-81350930 CACACACACATACTTCTTTAAGG + Intergenic
957742780 3:84294295-84294317 CAAAAACACAAATTATTTTGAGG + Intergenic
957855144 3:85865361-85865383 CATACACACATTTTATTTGGAGG - Intronic
957991446 3:87632269-87632291 CACACACAAGTAAGATTATGTGG - Intergenic
958455366 3:94324458-94324480 CAACCACAAATAATATTTAGTGG + Intergenic
959009557 3:101059612-101059634 CACACACACAAAAGATATTCAGG - Intergenic
959247156 3:103886487-103886509 CATACATACATAAAATCTTGAGG - Intergenic
959428336 3:106220860-106220882 CACACACACAAAAAAATTTCAGG - Intergenic
959567636 3:107848905-107848927 CACACACACAAAAGAATTTCAGG - Intergenic
960233002 3:115250741-115250763 CACATACACAAAGTGTTTTGTGG - Intergenic
960244273 3:115382069-115382091 CACACACACATATATTTCTGAGG - Intergenic
960644130 3:119859770-119859792 CAGACAGACTGAATATTTTGGGG - Intronic
960774638 3:121235854-121235876 CACACACACACTATATTCTCTGG + Intronic
961104783 3:124231760-124231782 CACAGACACATAAATTTTTAGGG - Intronic
961795575 3:129406461-129406483 CACACACACATCACATTCTAAGG - Intronic
962072761 3:132048761-132048783 CACACACACACAACAATTTTTGG + Intronic
962106100 3:132391341-132391363 CACACACACACACTTTGTTGGGG + Intergenic
962197207 3:133374569-133374591 CACACACATATATAATTTTGTGG + Intronic
962625411 3:137221012-137221034 CACACACACACACGTTTTTGTGG + Intergenic
962656703 3:137553304-137553326 TACACAAACATAATATTTAATGG + Intergenic
963176772 3:142306014-142306036 CACACACACATAGTGTATAGTGG + Intergenic
963205326 3:142628319-142628341 CACACACACACACTATATTCTGG - Intronic
963254673 3:143133094-143133116 GACACACATCTAATAATTTGAGG - Intergenic
963964662 3:151352614-151352636 CACATGAAAATAATATTTTGAGG + Intronic
964451811 3:156820499-156820521 AACCCACAAATAGTATTTTGTGG + Intergenic
965476224 3:169158882-169158904 ACCACACACAAAAAATTTTGGGG - Intronic
965519059 3:169654833-169654855 CACACACACATATTAACTTGAGG + Intronic
965923147 3:173944109-173944131 CACACACCCATAATATTAACTGG - Intronic
965960012 3:174417925-174417947 CACACACACATATTTTTTGTAGG + Intergenic
966229307 3:177633741-177633763 TTCACAAACAGAATATTTTGTGG - Intergenic
966519603 3:180858606-180858628 CATGCACAGATAATATTCTGTGG - Intronic
966870295 3:184286000-184286022 AACAAATACATTATATTTTGTGG + Intronic
967424848 3:189315268-189315290 CACACACACACAATTCTTTCAGG - Intronic
967768031 3:193303914-193303936 CACACACACATAATTTTTGCTGG + Intronic
967777684 3:193401230-193401252 CACCTACATATAATATTTTAAGG - Intergenic
968233902 3:197020498-197020520 CACACACACACAATAAAATGTGG + Intronic
968394538 4:222012-222034 GACACACACATACTATATTTTGG + Intergenic
969623478 4:8290607-8290629 CACACACACACGATAAATTGGGG - Intronic
969665607 4:8555702-8555724 CAGACACACACAAAGTTTTGGGG + Intergenic
969836053 4:9842757-9842779 CCCACATACATAATTATTTGGGG - Intronic
970202623 4:13625476-13625498 CACATACCAATAACATTTTGTGG + Intronic
970668668 4:18368894-18368916 CACACACACATAAAAAATTGAGG + Intergenic
970688527 4:18595535-18595557 CACACACACACAATATTTCTGGG + Intergenic
971093011 4:23366946-23366968 CACACACAAAAAATCTCTTGAGG + Intergenic
971131884 4:23820396-23820418 TACATATACATAAAATTTTGGGG + Intronic
971426951 4:26525445-26525467 CACACACACACAAAATGTAGGGG - Intergenic
971876678 4:32317560-32317582 CCCACACAAAGAATATTTTTAGG - Intergenic
972135323 4:35885787-35885809 GACTAACACATCATATTTTGGGG + Intergenic
972439168 4:39068427-39068449 CACACACACACAGTGTTTTCTGG - Intronic
972489494 4:39573452-39573474 CACAAACACAGAATACTCTGAGG + Intronic
972709029 4:41575049-41575071 CACACACACACAATTTATTGAGG + Intronic
972822855 4:42722366-42722388 CAGAAACACATGACATTTTGAGG - Intergenic
973126941 4:46597737-46597759 CACATACATATTATATTTTCTGG - Intergenic
973218096 4:47694449-47694471 CACACACACACAAGCTTTGGTGG - Intronic
974239735 4:59231273-59231295 CACACACACATAAAATATCTAGG + Intergenic
974473814 4:62354513-62354535 CACACACACATAAACATTTAAGG - Intergenic
974514649 4:62894053-62894075 CACACACACAATATTTTTTGTGG + Intergenic
974948273 4:68554576-68554598 CACACACACAAAAGATTATGTGG - Intronic
974957345 4:68657853-68657875 CACACACACAAAAGATTCTATGG - Intronic
975268725 4:72403402-72403424 TACTCACACATAAAATTCTGTGG + Intronic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
975534045 4:75430297-75430319 CTCACATACATCATTTTTTGTGG + Intergenic
976083451 4:81382280-81382302 CACACACATATTATTATTTGTGG - Intergenic
976145493 4:82039139-82039161 CACACACACATAATATTCAGTGG + Intronic
976518963 4:86004400-86004422 CACACACACAGGGTGTTTTGTGG + Intergenic
976737789 4:88328296-88328318 AACACAAACATTATATTTTTGGG + Intergenic
976886912 4:89996434-89996456 CATACACTACTAATATTTTGTGG + Intergenic
977068279 4:92347284-92347306 CACACACACTTTATAATTTCAGG - Intronic
977866362 4:102033008-102033030 CTTACATAAATAATATTTTGGGG - Intronic
978227781 4:106358977-106358999 CTCACAGTTATAATATTTTGTGG - Intergenic
978813153 4:112874053-112874075 CACACACACAAAAGCTCTTGGGG + Intronic
979046015 4:115865877-115865899 CACAAACACAAACTGTTTTGTGG + Intergenic
979114226 4:116800739-116800761 AACACACATATTTTATTTTGTGG - Intergenic
979715835 4:123836398-123836420 TACACACATACAATATTTGGAGG + Intergenic
980072205 4:128255193-128255215 CACACACACGTAATTAATTGTGG + Intergenic
980249252 4:130292870-130292892 CGCACACACACAATCTTTTGAGG - Intergenic
980321431 4:131283388-131283410 CACACATAGATTATAGTTTGAGG - Intergenic
980377738 4:131973060-131973082 CTCACAAACATAATATTTAGTGG - Intergenic
980407279 4:132368890-132368912 CACACACACACATATTTTTGGGG + Intergenic
980435413 4:132765700-132765722 CACACACACACAAGAATTTAAGG + Intergenic
980540227 4:134183900-134183922 CGCACACACACAATCTTTTAGGG - Intergenic
980598387 4:134987065-134987087 GACACAGACATAACATTTTTGGG - Intergenic
980739506 4:136930930-136930952 AACCCACATATAATATTTAGTGG + Intergenic
981139283 4:141249661-141249683 CACACAAACTAAAAATTTTGAGG - Intergenic
981269858 4:142832798-142832820 CACACACAAATAATTTTTACTGG + Intronic
981394501 4:144231781-144231803 CACATACTTATAATTTTTTGTGG + Intergenic
981882971 4:149637807-149637829 CACACACACAAATCAGTTTGAGG + Intergenic
981896894 4:149812519-149812541 CACACACACACTATCCTTTGAGG + Intergenic
982341739 4:154307341-154307363 CACACACACATATCTTTTAGTGG - Intronic
982942956 4:161581770-161581792 CCCTCATACATAATATTGTGCGG - Intronic
984206850 4:176795372-176795394 CACACACACAGAATGTCTTAAGG + Intergenic
984490405 4:180427478-180427500 AATACACACGAAATATTTTGGGG - Intergenic
985168247 4:187120606-187120628 CGCACACACATAATTTTTCCTGG - Intergenic
985272564 4:188207912-188207934 CACACACACACACTTTTTTGTGG - Intergenic
985859422 5:2458793-2458815 CACGCACACACAATGTTTTCTGG + Intergenic
985944831 5:3171980-3172002 TACACCAACATAATATTTAGGGG - Intergenic
986840182 5:11687638-11687660 CACACACAGATAATATCTGTAGG + Intronic
987553495 5:19414525-19414547 CACACACACCTTATTTTATGAGG - Intergenic
987844300 5:23262100-23262122 CAAAAACACAAAATATTCTGGGG + Intergenic
988250361 5:28749352-28749374 CACACACACACAATCTTTTCTGG + Intergenic
988694368 5:33605358-33605380 CACACAGAAATAAAATGTTGAGG + Intronic
988841011 5:35084006-35084028 CACACACATATATGAGTTTGGGG + Intronic
988928091 5:36009282-36009304 CACCCAGTCATAACATTTTGTGG + Intergenic
989365473 5:40651134-40651156 CACACACACATACACTTTTATGG + Intergenic
989462660 5:41718671-41718693 CACACACACACAAATGTTTGAGG - Intergenic
989999976 5:50881270-50881292 CATTCACAAACAATATTTTGGGG + Intergenic
990314661 5:54572718-54572740 CACACACACACACAATTTGGAGG - Intergenic
990662955 5:58038980-58039002 CACACACACACAATATGACGGGG + Intergenic
991454624 5:66789214-66789236 CATACACACATGATTTTTTGAGG + Intronic
992040754 5:72828520-72828542 CATACACACACAAATTTTTGGGG + Intronic
992975932 5:82119974-82119996 CACACACACACAATAAATGGTGG - Intronic
994084204 5:95740856-95740878 CACACACACACACTTTTTTTTGG + Intronic
994126669 5:96174815-96174837 ACCACACAAATACTATTTTGGGG - Intergenic
994490523 5:100437699-100437721 TGCATACACATAATATTTTGGGG + Intergenic
994961868 5:106615407-106615429 CACACACACAGAGTATGATGAGG + Intergenic
994962154 5:106619383-106619405 TACAAACACATAGTTTTTTGAGG + Intergenic
995044431 5:107629366-107629388 CACACACACATTGCATTTTGGGG + Intronic
995284950 5:110377520-110377542 CAAACACACACAATAATATGTGG + Intronic
995301329 5:110587217-110587239 CACACACACACAATAAATTCAGG + Intronic
996029201 5:118685933-118685955 CACATACACATTGTATTTTGAGG + Intergenic
997219327 5:132147082-132147104 CACACACAGATAAATGTTTGAGG + Intergenic
997741903 5:136262713-136262735 CAAACATAAATAATATTTTTAGG + Intronic
998701600 5:144708826-144708848 CACACACACAAATTAATTTTAGG + Intergenic
998711785 5:144834228-144834250 AAAACACACATAATGTTTAGAGG + Intergenic
998734422 5:145119429-145119451 CACATAATTATAATATTTTGGGG - Intergenic
998874446 5:146585293-146585315 CACACACACATAATGTATGATGG + Intronic
999294578 5:150450636-150450658 CACACACACAAAAAATTTGTCGG - Intergenic
999507762 5:152215946-152215968 CACACACACAAAAAAGTATGTGG - Intergenic
999740501 5:154546407-154546429 CACACACACAGAGTTTATTGAGG - Intergenic
999843332 5:155452196-155452218 CACACACACATAGTCTTTTAAGG - Intergenic
1000060249 5:157648939-157648961 CACACACACACACAATTTTAAGG + Intronic
1000164971 5:158639533-158639555 AACACATGCATAATATATTGTGG + Intergenic
1000687946 5:164275971-164275993 CACACACACGTAGCACTTTGGGG + Intergenic
1001251275 5:170148859-170148881 CACACACACACACCATTATGTGG - Intergenic
1001536569 5:172502291-172502313 CACACACACAAAATAAGTTGGGG - Intergenic
1001962621 5:175889116-175889138 CACACTCAACTAATATTTTGGGG - Intergenic
1001977470 5:176011944-176011966 CACACACACATATATTTTAGAGG + Intronic
1002123582 5:177024167-177024189 CACACACACACACTATTTCTGGG + Intronic
1002239952 5:177831825-177831847 CACACACACATATATTTTAGAGG - Intergenic
1002463491 5:179388978-179389000 CACACACACACACGATGTTGGGG + Intergenic
1002766574 6:245150-245172 AAAACAAACAAAATATTTTGAGG + Intergenic
1002866984 6:1130401-1130423 GACACACACATCATATGTGGTGG + Intergenic
1003057050 6:2831429-2831451 CAAACAAAAATCATATTTTGGGG - Intergenic
1003859934 6:10313686-10313708 CACACACACAGATTTTTTTATGG - Intergenic
1004002026 6:11604644-11604666 CATACATACATACGATTTTGTGG + Intergenic
1004032991 6:11890533-11890555 CTCTAACAAATAATATTTTGAGG - Intergenic
1004059966 6:12184957-12184979 CACACACAATGAATATTTAGAGG + Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1005900267 6:30211266-30211288 CACACACACACAATTTTGGGGGG + Intronic
1005934225 6:30507694-30507716 CACACACACACACTTTGTTGTGG - Intergenic
1006537305 6:34710171-34710193 CACACACACACACTCTTTTGTGG - Intergenic
1006720990 6:36150974-36150996 CACACACACTTTTTATTTTAAGG + Intergenic
1007339251 6:41179924-41179946 CACACACACACAATCTTTAAGGG + Intergenic
1007371391 6:41428561-41428583 TAAACACAAATAATATTTTATGG - Intergenic
1007608146 6:43131066-43131088 CACACACACACACTTTTTAGAGG + Intronic
1007669122 6:43536819-43536841 CACACACAGAAAAAATTTTCAGG - Intronic
1007856451 6:44863294-44863316 CACACACACACAGTATTTGTGGG + Intronic
1008656169 6:53616472-53616494 CACACACACAAAAAATCTTTAGG + Intronic
1008730083 6:54471377-54471399 AACATACACATAAAATTATGTGG + Intergenic
1008731215 6:54484806-54484828 CTCAGACACATAAAGTTTTGGGG + Intergenic
1009432625 6:63583304-63583326 CACACAAACATATTAATTTAAGG - Exonic
1009532427 6:64836431-64836453 TACACACACATATATTTTTGGGG + Intronic
1009586526 6:65613519-65613541 CTCACACACAGAATATTTCAGGG - Intronic
1009722726 6:67495307-67495329 CACAAACCCAAAATCTTTTGTGG - Intergenic
1009822108 6:68815593-68815615 CACACACACACAATTTTTGATGG - Intronic
1009871312 6:69455198-69455220 CTCACATAGATATTATTTTGTGG - Intergenic
1009966864 6:70587187-70587209 CACACACACACAAGAATTAGGGG + Intronic
1010058007 6:71588031-71588053 CACACATACTTATTAATTTGTGG + Intergenic
1010494971 6:76522922-76522944 CATACACAAATATTATGTTGGGG - Intergenic
1010708929 6:79149544-79149566 CTCTCAAACATAATATTTTGGGG - Intergenic
1010823004 6:80437775-80437797 CAAACACTCTAAATATTTTGTGG + Intergenic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1011842246 6:91516268-91516290 CACACACACATACACCTTTGTGG - Intergenic
1011996400 6:93594542-93594564 CAAACACAGGTAATATCTTGTGG + Intergenic
1012206055 6:96461772-96461794 CACACACACACATTTTTTGGGGG - Intergenic
1012517856 6:100083769-100083791 TAAACACTCATAATATATTGTGG + Intergenic
1012911075 6:105118849-105118871 CACAAACACATATTAATTAGTGG + Intronic
1012924894 6:105257723-105257745 CACACAAAGAAAATAATTTGAGG - Intergenic
1013727977 6:113123975-113123997 CACACACACAGATAATTTTATGG - Intergenic
1014071679 6:117188800-117188822 CACACACACCCTAAATTTTGTGG + Intergenic
1014618418 6:123634028-123634050 CACACACACAAAACAGTTTGTGG - Intronic
1015009595 6:128329400-128329422 CACACACACACAATATTACAAGG + Intronic
1015209832 6:130684584-130684606 CACACACCTACAATATCTTGGGG - Intergenic
1015448006 6:133330584-133330606 CACACACACATACTTTTTTGGGG + Intronic
1015530902 6:134220263-134220285 CACAGAATCATAGTATTTTGTGG + Intronic
1015581867 6:134734263-134734285 AATACACACATAGTATTCTGTGG + Intergenic
1015692650 6:135942470-135942492 CTCACATACTTAATGTTTTGTGG + Intronic
1015977389 6:138804600-138804622 CACACACACACAATATTTCTTGG + Intronic
1016167450 6:140964474-140964496 CACACAGAGAAAATATCTTGCGG - Intergenic
1017099281 6:150833203-150833225 CACACACACAAAAAAATTAGCGG - Intronic
1017986864 6:159451591-159451613 CACACACACACACTTTTTTCTGG + Intergenic
1017998264 6:159553926-159553948 GATACATACAAAATATTTTGAGG + Intergenic
1018706477 6:166467394-166467416 CAGAAACACATGGTATTTTGAGG + Intronic
1018966439 6:168493988-168494010 CCCACACTCATAATATTTTAAGG - Intronic
1020776392 7:12459313-12459335 CACACACACACAGGAATTTGAGG + Intergenic
1020821786 7:12978280-12978302 CTCACATACTTATTATTTTGTGG - Intergenic
1021282105 7:18733694-18733716 CACACATATATATTTTTTTGGGG + Intronic
1022976859 7:35566681-35566703 CACACATATTTAATTTTTTGAGG - Intergenic
1023149844 7:37191920-37191942 CACACACACAAAATGTTATCTGG + Intronic
1023173394 7:37412047-37412069 CACACACACACAAAATGTTTTGG + Intronic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1024801894 7:53089072-53089094 CACACACACACAATTTTTGTTGG - Intergenic
1024804828 7:53126549-53126571 CAGACATACATAATAATTTGCGG + Intergenic
1024843079 7:53610227-53610249 GAAACTAACATAATATTTTGAGG - Intergenic
1025307374 7:57874324-57874346 AACAGACACATAATAATTTGCGG + Intergenic
1025481306 7:60986837-60986859 AACAGACACATAATAATGTGCGG - Intergenic
1025838335 7:65118119-65118141 AACAGACACATAATAATTTGCGG - Intergenic
1025878941 7:65514963-65514985 AACAGACACATAATAATTTGCGG + Intergenic
1025884738 7:65577858-65577880 AACAGACACATAATAATTTGCGG + Intergenic
1026072692 7:67136616-67136638 CACACACACATACTAATATATGG - Intronic
1026704191 7:72675621-72675643 CACACACACATACTAATATATGG + Intronic
1027255284 7:76426897-76426919 CACACACACACAATAGGGTGTGG + Intronic
1027507450 7:79035178-79035200 CACACACACACTTTTTTTTGTGG - Intronic
1027714087 7:81647430-81647452 CACACACACAATGTATTTTCTGG + Intergenic
1027732434 7:81891952-81891974 CTCACATACTTATTATTTTGTGG - Intergenic
1027753100 7:82176853-82176875 CACTCACACATAATATCATGTGG + Intronic
1028390345 7:90309576-90309598 CCCATTGACATAATATTTTGGGG - Intronic
1028661397 7:93280924-93280946 CACACTCATATATTATTTGGGGG + Intronic
1028681319 7:93536924-93536946 AATACACACAAAATATTTTAGGG + Intronic
1028698085 7:93740960-93740982 CACACACACAAAAAATGATGGGG - Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1029741882 7:102495695-102495717 CACACACACATTCTCTTTGGGGG + Intronic
1029759873 7:102594864-102594886 CACACACACATTCTCTTTGGGGG + Intronic
1029777235 7:102690774-102690796 CACACACACATTCTCTTTGGGGG + Intergenic
1030493011 7:110263048-110263070 CACACACACATATAACTGTGTGG + Intergenic
1030570559 7:111217149-111217171 CACACACACACAATATGCAGTGG + Intronic
1030897519 7:115079333-115079355 CACACACACACAATTTTTTCTGG + Intergenic
1031011294 7:116526811-116526833 CACACACACACAGAGTTTTGTGG + Intronic
1031198784 7:118650686-118650708 CCCACACACACAATCTTCTGAGG + Intergenic
1031207505 7:118779606-118779628 CACACACACAAATTGTTTTGTGG - Intergenic
1032111411 7:129079065-129079087 CACACACAGCTAATTTTTTAAGG - Intergenic
1032598195 7:133263719-133263741 CACACACATATAAATTTTTATGG - Intronic
1032691493 7:134291965-134291987 CACACACACACTGTATTTTCTGG + Exonic
1033253363 7:139778318-139778340 CACACACACACAAAGTTCTGGGG - Exonic
1033467164 7:141604417-141604439 CACACACACATATTATTTTCTGG + Intronic
1033951438 7:146789866-146789888 CTCACATACTTTATATTTTGTGG - Intronic
1033982958 7:147188388-147188410 CATACACGCATGATATTTTGTGG + Intronic
1034168138 7:149041609-149041631 CACACACACATATGAAATTGTGG - Intergenic
1034301460 7:150018903-150018925 CACACACACACACCATTTTAAGG - Intergenic
1034804587 7:154078377-154078399 CACACACACACACCATTTTAAGG + Intronic
1034824821 7:154252200-154252222 CACACACACGTGACATTGTGAGG - Intronic
1035045600 7:155963488-155963510 CTCTCTCACATCATATTTTGAGG + Intronic
1035707344 8:1686886-1686908 CACACACACATAAATGTTTGAGG + Intronic
1036024100 8:4883571-4883593 TAGAATCACATAATATTTTGTGG + Intronic
1036155405 8:6337632-6337654 CACAAACACTTGATATTTTTTGG - Intergenic
1036437435 8:8747788-8747810 CACACAAAAATTATGTTTTGGGG - Intergenic
1036824378 8:11964960-11964982 CACACACAAATATTTTTGTGAGG - Intergenic
1036958889 8:13221670-13221692 CACACACACACAAAATCTTTGGG - Intronic
1038341173 8:26686386-26686408 CACACACACTTATTTTCTTGTGG + Intergenic
1038380423 8:27087798-27087820 GACCCAGAAATAATATTTTGGGG - Intergenic
1039586267 8:38709766-38709788 CACACACACAAAATATTAGCTGG - Intergenic
1039712891 8:40075212-40075234 CACACACACACAGCATTTTTTGG + Intergenic
1040122386 8:43697599-43697621 CACACTCATTAAATATTTTGTGG - Intergenic
1040370989 8:46774100-46774122 CACACACACAAAAGTTTGTGAGG - Intergenic
1040584173 8:48724853-48724875 GAGACATACAGAATATTTTGTGG - Intronic
1040641673 8:49341461-49341483 AACACACACTTAATATGATGGGG - Intergenic
1040770002 8:50962337-50962359 CACACACACATAATTTTTTAAGG + Intergenic
1041057292 8:53999497-53999519 CACACACAAATTATTTTTTTCGG - Intronic
1041363063 8:57072121-57072143 CACACACACAAAATATTAGCCGG + Intergenic
1041675278 8:60532122-60532144 CACTCACTCTTAGTATTTTGTGG + Intronic
1041808663 8:61883949-61883971 CACACACAGCTAATATTTAATGG - Intergenic
1042223723 8:66498593-66498615 CACACACACAAAAGATTTAAAGG - Intronic
1042280791 8:67053704-67053726 CACACACAAAGAACATTTTTGGG + Intronic
1042686239 8:71443958-71443980 GCCAGACACATAATAATTTGAGG + Intronic
1043119369 8:76303360-76303382 CATACATATATAATGTTTTGCGG + Intergenic
1043642810 8:82478019-82478041 CCCACATACATAAAATTTTGTGG - Intergenic
1043696681 8:83228214-83228236 GACACACACAAAATATCTAGTGG - Intergenic
1043743233 8:83840986-83841008 CACACACACAAAATACTCTTTGG + Intergenic
1044096752 8:88075966-88075988 CACACACACAAAATCTACTGAGG + Intronic
1044329980 8:90907112-90907134 CACACACACACAAAATTGGGTGG - Intronic
1044390691 8:91647255-91647277 CACACACACATAAAGTGTTGGGG - Intergenic
1044422860 8:92018482-92018504 CACACACCCAACGTATTTTGAGG + Intronic
1044897553 8:96908768-96908790 CACACACACACCATATATTCTGG + Intronic
1044897555 8:96908770-96908792 CACACACACCATATATTCTGGGG + Intronic
1045576245 8:103423677-103423699 CTCACATACTTATTATTTTGTGG - Intronic
1045581483 8:103485527-103485549 CACACACAAAAAATATGCTGTGG - Intergenic
1045763415 8:105637947-105637969 CACACACACACACAATTTTTTGG - Intronic
1045777447 8:105822391-105822413 CACAAAGACAGAATATTCTGAGG - Intergenic
1045945184 8:107787707-107787729 TACACATATATAATATTTTAAGG + Intergenic
1046041535 8:108911666-108911688 CATACACACATAATTGTGTGTGG - Intergenic
1046042377 8:108921411-108921433 CACACACACATATTATATATAGG + Intergenic
1046210089 8:111060790-111060812 TACACACACATGAAATTTTATGG + Intergenic
1046218148 8:111176740-111176762 CACACTAACATACTATTTTCTGG + Intergenic
1046351749 8:113024278-113024300 CACACACACACAATACTCAGTGG - Intronic
1046580496 8:116086686-116086708 CAAAGTCACATAATATTTGGTGG - Intergenic
1046848518 8:118946409-118946431 CACTACCACAGAATATTTTGGGG - Intronic
1047359745 8:124157744-124157766 CACACACACATAAAATATCTTGG - Intergenic
1047907085 8:129483670-129483692 CACACACACACATCATTTTTGGG + Intergenic
1048722214 8:137338620-137338642 CACACACACATAAAATTTCATGG + Intergenic
1049031599 8:140042193-140042215 CACACACACATACACTTTTTTGG - Intronic
1050413158 9:5387038-5387060 CACACACACATTAAAGTTTGAGG - Intronic
1050576572 9:7002421-7002443 CTTAAATACATAATATTTTGTGG + Intronic
1050708243 9:8428663-8428685 CACACACACACAATTTTTTTTGG - Intronic
1052712848 9:32078195-32078217 CACATGCACATAGTCTTTTGTGG + Intergenic
1053642759 9:40103476-40103498 CTCACAAACATAGTATTTAGTGG - Intergenic
1053698032 9:40656666-40656688 AACAGACACATAGTAATTTGCGG + Intergenic
1053763395 9:41362014-41362036 CTCACAAACATAATATTTAGTGG + Intergenic
1053877545 9:42559492-42559514 CACACACACATAAAACTCTCAGG + Intergenic
1054234149 9:62542202-62542224 CACACACACATAAAACTCTCAGG - Intergenic
1054309323 9:63456074-63456096 AACAGACACATAGTAATTTGCGG + Intergenic
1054323614 9:63700727-63700749 CTCACAAACATAATATTTAGTGG - Intergenic
1054408119 9:64780196-64780218 AACAGACACATAGTAATTTGCGG + Intergenic
1054441265 9:65264022-65264044 AACAGACACATAGTAATTTGCGG + Intergenic
1054489011 9:65757467-65757489 AACAGACACATAGTAATTTGCGG - Intergenic
1054542004 9:66273181-66273203 CTCACAAACATAGTATTTAGTGG + Intergenic
1055181604 9:73394319-73394341 CATACACACACACTATTTTGGGG + Intergenic
1055189446 9:73499234-73499256 AACACACACACTATATTTTTAGG + Intergenic
1055299981 9:74872590-74872612 CACACACACACAAAATTTGCTGG - Intronic
1055389702 9:75807112-75807134 CACAAATATATAATGTTTTGGGG - Intergenic
1055511156 9:76996935-76996957 CTGACACACATACTGTTTTGGGG - Intergenic
1055852332 9:80646947-80646969 CACACACACAAAAAGTTTAGCGG - Intergenic
1055876504 9:80949054-80949076 CACACACACACACATTTTTGTGG + Intergenic
1055884061 9:81038285-81038307 CACACACAAAGAATATTCTGGGG + Intergenic
1057008868 9:91584077-91584099 TACGCTCACATACTATTTTGGGG + Intronic
1057098009 9:92329713-92329735 CACACACACACAAAATTATCTGG - Intronic
1058291704 9:103250134-103250156 CACACACACACACTCTTTTTTGG - Intergenic
1058761250 9:108135242-108135264 CACACACACTAAATATTTGCAGG + Intergenic
1058944647 9:109844921-109844943 CACACACACACATCATTTTCTGG - Intronic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1059078021 9:111215626-111215648 CACACACACATATATTTTAGAGG + Intergenic
1059162587 9:112049345-112049367 CACAGACTCATAATACTCTGTGG + Intronic
1059972716 9:119684115-119684137 CAAACAAACAAAAAATTTTGAGG - Intergenic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1202780396 9_KI270717v1_random:29856-29878 AACAGACACATAGTAATTTGCGG + Intergenic
1202790509 9_KI270719v1_random:86468-86490 CTCACAAACATAATATTTAGTGG - Intergenic
1203531864 Un_GL000213v1:152382-152404 CACACACACATATTATGTTTTGG - Intergenic
1203582129 Un_KI270746v1:18150-18172 AACAGACACATAATAATTTGCGG - Intergenic
1186016797 X:5204755-5204777 CACACACACGTAATTCTGTGAGG - Intergenic
1186527584 X:10263533-10263555 CACACACACAAATCATTCTGGGG + Intergenic
1186657423 X:11630001-11630023 CACACACACACACTAGTTGGGGG - Intronic
1187233831 X:17447810-17447832 CACACACACAGAGGATTTTCTGG + Intronic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1187622786 X:21077297-21077319 CACACACACACACCATTTTCAGG + Intergenic
1188359224 X:29232295-29232317 AAAACACACATTATATTTTTAGG + Intronic
1188406192 X:29813160-29813182 CATACATACATAATATTTCCCGG - Intronic
1188529314 X:31121416-31121438 CACACACACACAAAACTTTGAGG - Exonic
1188636213 X:32435313-32435335 CACACACACACAATTTTTGAGGG + Intronic
1188910252 X:35838826-35838848 CACACACACATATAATTTTAAGG - Intergenic
1189208937 X:39266484-39266506 CACACAAAAAAAATGTTTTGAGG + Intergenic
1189430315 X:40940521-40940543 CTCACAAACTTACTATTTTGTGG + Intergenic
1189639463 X:43051885-43051907 CACACACTCACCATTTTTTGTGG + Intergenic
1189847927 X:45153464-45153486 CACACACACACAAAACTTTTGGG - Intronic
1190158819 X:48015862-48015884 CACACCCAGCTAATATTTTCTGG - Intronic
1190174518 X:48138141-48138163 CACACCCAGCTAATATTTTCTGG - Intergenic
1190188932 X:48259388-48259410 CAAACACACAGAATAGTATGGGG - Intronic
1190537502 X:51444123-51444145 CACATATCCACAATATTTTGAGG + Intergenic
1193276304 X:79592123-79592145 TACACACAAATAAAATTTTCAGG - Intergenic
1193810147 X:86041658-86041680 CATACACACATATGTTTTTGGGG - Intronic
1194224577 X:91240272-91240294 CACACACACAAAAAATCTGGAGG - Intergenic
1194300099 X:92175724-92175746 CACACACAAATACTCTTTTCAGG - Intronic
1194337486 X:92665836-92665858 CACACACACACAATTTTGGGAGG + Intergenic
1194345158 X:92754350-92754372 CACACACACATAGTATTCCATGG - Intergenic
1194402186 X:93452077-93452099 CACACCCACACAATAATATGGGG - Intergenic
1194597052 X:95871305-95871327 CACACACACACAAAACTTTCAGG + Intergenic
1195366308 X:104129848-104129870 CACACACACATACATTTGTGTGG - Intronic
1195444211 X:104932584-104932606 CACACACACACAATCATTTATGG + Intronic
1197157936 X:123290576-123290598 CACACACACACAGTCCTTTGAGG - Intronic
1197261812 X:124327927-124327949 CACACACACATACAACTTAGAGG - Intronic
1197274354 X:124460904-124460926 CCCATACACAAAACATTTTGTGG - Intronic
1198303999 X:135362204-135362226 CACACACACATACTACTTTAAGG + Exonic
1198391263 X:136177037-136177059 CACACACACATAATGTCTCAAGG + Intronic
1198758457 X:140005706-140005728 CTCACATACTTATTATTTTGTGG - Intergenic
1198780301 X:140227882-140227904 CTCACATACTTATTATTTTGTGG + Intergenic
1199039040 X:143088817-143088839 CACACACACAAAAGATTATCTGG - Intergenic
1199471654 X:148202395-148202417 CACACACACAATAAAATTTGTGG - Intergenic
1199903610 X:152202487-152202509 CACACACACATAATCTTTCTAGG - Intronic
1199933706 X:152550917-152550939 CACACACACACCCTTTTTTGTGG + Intergenic
1200233200 X:154455929-154455951 CACACACACAGTTTATTTTAAGG + Intergenic
1200561040 Y:4703587-4703609 CACACACACAAAAAATCTGGAGG - Intergenic
1200653499 Y:5870995-5871017 CACACACACATAGTATTCCATGG - Intergenic
1201500865 Y:14641142-14641164 CACACAAGCAGAATACTTTGTGG - Intronic
1201953801 Y:19598024-19598046 CACACACACACAAAATCTTATGG - Intergenic