ID: 957369037

View in Genome Browser
Species Human (GRCh38)
Location 3:79267063-79267085
Sequence AAATATCCACATATGGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1189
Summary {0: 1, 1: 1, 2: 37, 3: 227, 4: 923}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957369037 Original CRISPR AAATATCCACATATGGATAG TGG (reversed) Intronic
901715927 1:11154099-11154121 AAAAAGCCACATGTGGCTAGAGG + Intronic
901900717 1:12359523-12359545 AAATAGCCACATATGGCTACTGG + Intronic
902206537 1:14872317-14872339 TAATATCCACATGTGGCCAGTGG - Intronic
902311028 1:15581872-15581894 AAGTAGCCACATGTGGCTAGTGG + Intronic
903633499 1:24796072-24796094 AAATAGCCACATATGACTAATGG - Intronic
904942504 1:34174938-34174960 CAGTAGCCACATATGGCTAGTGG - Intronic
905725444 1:40247289-40247311 AAATAGCCACCTGTGGCTAGTGG - Intronic
905756131 1:40510795-40510817 AAGTAGCCACATATGGCTAGTGG + Intronic
905841963 1:41188442-41188464 AAATAGCCACATGTGGCTAGTGG - Intronic
905949556 1:41937484-41937506 CAATAGCTACATATGGCTAGTGG - Intronic
906917679 1:50028973-50028995 TAATAGCCATATATGGCTAGTGG + Intergenic
906932676 1:50184916-50184938 AAATAGCCATATATTGCTAGTGG - Intronic
907447560 1:54518606-54518628 AAATAGCCACATGTCGCTAGTGG + Intergenic
907872811 1:58458207-58458229 CAATAGCCACATGTGGCTAGTGG + Intronic
908018513 1:59874185-59874207 CAATAGCCACATGTGGCTAGTGG + Exonic
908430093 1:64048218-64048240 AAATAGCCACATGTGGCTAGTGG - Intronic
908713585 1:67045701-67045723 AAATAGCTACATGTGGCTAGTGG - Intronic
908748318 1:67396649-67396671 AAATCGCCACACATGGCTAGTGG + Exonic
909073737 1:71027927-71027949 AAATAACCATATGTGGCTAGTGG + Intronic
909173130 1:72319803-72319825 AAATAGCCACACATGGCGAGTGG + Intergenic
909489888 1:76214139-76214161 AAATAGTCACATATGAGTAGTGG - Intronic
909539374 1:76773586-76773608 AAATAGCCACATGTGGCTAGTGG - Intergenic
909650451 1:77970403-77970425 CAATAACCACATATGGCTAGTGG - Intronic
909814856 1:79979057-79979079 AAATAACTACATTTGGCTAGTGG + Intergenic
909866571 1:80680528-80680550 AAATAGCCACATATGACTAGTGG + Intergenic
910544347 1:88397223-88397245 CAATAGCCACATGTGGCTAGTGG - Intergenic
910655397 1:89613214-89613236 GAATAGCCACATGTGGCTAGCGG - Intergenic
911140135 1:94492135-94492157 AAATAGCCACATGTGAGTAGTGG + Intronic
911202496 1:95059829-95059851 ACGTAGCCACATATGGCTAGTGG + Intronic
911204453 1:95078405-95078427 AAATAGACACATGTGGCTAGTGG + Intergenic
911261219 1:95688618-95688640 AATTAGCCACATATGTCTAGTGG - Intergenic
911465260 1:98243958-98243980 AAATAGCCACATATGACTAGTGG + Intergenic
911552169 1:99296313-99296335 CAATACCTACATATGGGTAGTGG + Intronic
911567259 1:99477053-99477075 AAATAGCCACATGTGTCTAGTGG - Intergenic
911615845 1:100010017-100010039 AAATAGCTACATATGGCTTGTGG - Intronic
911626573 1:100131585-100131607 TAATAACCACATGTGGCTAGTGG + Intronic
911631616 1:100190034-100190056 AAATAGCTACATGTGGCTAGAGG + Exonic
911700185 1:100943538-100943560 AAAGATCCAGATAGGGAGAGCGG - Intronic
912229830 1:107779852-107779874 AAATAGCCTCATGTGGCTAGTGG - Intronic
912304369 1:108551398-108551420 AAATACCCACATGTGGCTAATGG - Intergenic
912329592 1:108806361-108806383 AAATAGCCTCATGTGGCTAGTGG + Intronic
912344611 1:108953019-108953041 CAATAGTCACATATGGGTAGTGG + Intronic
912837617 1:113010122-113010144 AAATAAACAAATATGGAAAGGGG + Intergenic
912915379 1:113809772-113809794 AATTAGTCACATATGGCTAGTGG - Intronic
913091216 1:115477958-115477980 AAATAGTCACATGTGGCTAGTGG - Intergenic
913372884 1:118120341-118120363 AAATAGCCACAAGTGGCTAGTGG + Intronic
914424711 1:147564885-147564907 AAATGGCCACATACGGATAGTGG - Intronic
917156740 1:172009457-172009479 TAATAGCCACATGTGGATAAAGG - Intronic
917344437 1:174014398-174014420 ACATAGCCACATATAGTTAGTGG + Intronic
918115566 1:181493747-181493769 AAATAGCCACATATGGCTAGTGG + Intronic
918133422 1:181648127-181648149 AAATCTCCACAGATTGAGAGGGG + Intronic
918217959 1:182409447-182409469 AAATAGCCACATGTGGTTAGTGG - Intergenic
918682233 1:187370052-187370074 AAATATCCACATATTTACTGTGG + Intergenic
918708715 1:187701223-187701245 CAATATCGACATATGGCTGGTGG - Intergenic
918823149 1:189285440-189285462 AAATATCCACATAAGGTTTGGGG + Intergenic
918966917 1:191362702-191362724 AAATATCCACACCTGGAAATGGG + Intergenic
919298151 1:195727682-195727704 AAAAATACAACTATGGATAGAGG - Intergenic
919612630 1:199764353-199764375 AAATATCCACATGTGGCTAGTGG - Intergenic
919729591 1:200904526-200904548 AAATAGCCACATGCGGCTAGTGG + Intronic
919930219 1:202216475-202216497 CAATAGCCACATAAAGATAGTGG - Intronic
919941859 1:202292858-202292880 AAATAGCCACACATGCCTAGTGG + Intronic
920413593 1:205782354-205782376 AAATAACCACACATGGCTACTGG - Intergenic
921035898 1:211377815-211377837 ACAGATCCACATAAGGATTGGGG + Intergenic
921220627 1:212971186-212971208 AAATATCCATCGATGGATAAAGG - Intronic
921504192 1:215946679-215946701 CAATAGCCATATGTGGATAGGGG - Intronic
921636853 1:217505772-217505794 AAATAACCATAGATGGCTAGTGG - Intronic
921760983 1:218914793-218914815 AAAAATCCACATATCGATTCTGG - Intergenic
921887197 1:220318966-220318988 AAATAGCCCCCTGTGGATAGTGG + Intergenic
921940826 1:220837656-220837678 AAATATCCAGATTTTGATAATGG + Intergenic
922026352 1:221752918-221752940 AAATAGCCACATGTGGCTAGTGG - Intergenic
922924063 1:229332788-229332810 CAATACCCACATGTGGCTAGTGG + Intronic
923360074 1:233202582-233202604 AAATGTCCTCATATGGACTGAGG + Intronic
923370415 1:233305805-233305827 AAATATCCACTTAACAATAGAGG + Intergenic
923551712 1:234969569-234969591 AAATAGCCACATATGGTTTGGGG + Intergenic
923788733 1:237093057-237093079 TAATAACCACATGTGGCTAGTGG - Intronic
923796490 1:237162013-237162035 AAATATCCACACAGAGCTAGAGG - Intronic
924138820 1:241000598-241000620 AATTAGCTACATATGGCTAGTGG - Intronic
924217278 1:241836330-241836352 CAATAGCCACATGTGGTTAGTGG - Intergenic
924219928 1:241863757-241863779 AAATAGCCACACATGGCTAGTGG - Intronic
924310491 1:242737421-242737443 AAATATCCACTTCTGAATATTGG - Intergenic
924319428 1:242832932-242832954 AAAAATTCACAAATGGAAAGAGG + Intergenic
924360568 1:243237393-243237415 ACATATTCATATATGGCTAGTGG + Intronic
1063433680 10:6013390-6013412 AAGTATCCACAGGTGGCTAGTGG + Intronic
1064187419 10:13174581-13174603 AAATATCCACAGGTGGCTAGTGG - Intronic
1064787290 10:18912129-18912151 CACTATCCACATATGGCTGGTGG + Intergenic
1064912425 10:20416985-20417007 AAATTTCAACATATGAATGGGGG - Intergenic
1065198994 10:23296148-23296170 AAATATCGACACATGCATACAGG - Intronic
1065236106 10:23654235-23654257 AAAAAGCCACACATGGTTAGTGG + Intergenic
1065694572 10:28368188-28368210 AAATATCCCCATATGGTGGGAGG - Intergenic
1065888156 10:30097237-30097259 AAATAGCCACATGTGGCTAGTGG + Intronic
1066260158 10:33721827-33721849 AAATAGCCGCATGTGGCTAGTGG + Intergenic
1066392039 10:34985232-34985254 AAATAACCACATATGGCTAGTGG + Intergenic
1066611502 10:37253272-37253294 CAATAGCCACATGTGGCTAGTGG - Intronic
1067122454 10:43485668-43485690 CAATATCCACATATGGCTAGTGG - Intergenic
1067555941 10:47271674-47271696 AAAGATCCACATTTGAATGGAGG + Intergenic
1067798524 10:49339025-49339047 AAACAGCCACATTTGGCTAGTGG - Intergenic
1068734361 10:60394975-60394997 CAGTAGCCACATATGGCTAGTGG - Intronic
1068829773 10:61480145-61480167 AAATGGCCACATGTGGCTAGTGG + Intergenic
1069197338 10:65569791-65569813 AAATAGCCACATGTGACTAGTGG + Intergenic
1069231505 10:66014748-66014770 AAAAAGCCACATTTGGCTAGGGG + Intronic
1069823866 10:71243503-71243525 AAACAGCCACATATGGCTAGTGG + Intronic
1070529196 10:77321671-77321693 AAATAGACTCATATGGACAGGGG - Intronic
1070694861 10:78554669-78554691 AAATAGCCATATGTGGCTAGTGG - Intergenic
1070937758 10:80314757-80314779 ACATATCCACATATCTATACAGG + Intergenic
1071156282 10:82692826-82692848 AAACATCAAGATATTGATAGAGG - Intronic
1071311992 10:84351846-84351868 TAATAGCCACATTTGGCTAGTGG + Intronic
1071588624 10:86849664-86849686 GAGTAGCCACATATGGTTAGTGG + Intronic
1071775893 10:88787490-88787512 ATATAGCCACATGTGGCTAGTGG - Intergenic
1071787041 10:88912715-88912737 AAATAACCACATGTGGCTAGTGG + Intronic
1072099126 10:92212583-92212605 CAATAGCCACATGTGGTTAGTGG - Intronic
1072321597 10:94255311-94255333 AAATACCCACATCTAGTTAGTGG - Intronic
1072552518 10:96489587-96489609 CAATAACCACATGTGGTTAGCGG - Intronic
1072615343 10:97045897-97045919 AAATAGCTACATGTGGCTAGTGG - Intronic
1072936707 10:99720069-99720091 AAATATCCACATGAGGCTACAGG + Intronic
1073069831 10:100786394-100786416 TAATGTCCACAGATGAATAGAGG - Intronic
1073327912 10:102653129-102653151 AAATAGCCACATATGACTAGTGG + Intronic
1073383199 10:103097595-103097617 AATTATACACATATTTATAGGGG + Intronic
1073482454 10:103795246-103795268 AAATAGCCACATGTGGCTAGTGG + Intronic
1073731387 10:106292389-106292411 GAATATCCACAGATGGGCAGAGG + Intergenic
1073770447 10:106729668-106729690 AAATATGCATATTTTGATAGTGG - Intronic
1073812746 10:107168420-107168442 AAAAATCCACATGTGGATAAAGG + Intergenic
1073988372 10:109235472-109235494 AAATAGTCGCATATGGCTAGTGG - Intergenic
1074108393 10:110405345-110405367 TAATAGCCACATATAGCTAGTGG - Intergenic
1074343794 10:112660706-112660728 AAATAGCCCCATGTGGCTAGTGG + Intronic
1074589304 10:114797674-114797696 CAATAGCCACATGTGGCTAGTGG - Intergenic
1074644580 10:115432290-115432312 CAATAGCCACATATGGCTAGTGG + Intronic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1074736319 10:116437834-116437856 CAATAGCCACATGTGGCTAGTGG + Intronic
1075032803 10:119037505-119037527 AAGTAACCACATATGGGTAGTGG - Intronic
1075775751 10:124985678-124985700 AAATATCTAAATATTGAAAGGGG - Exonic
1075928185 10:126270542-126270564 AAATAGCCACATGTGGCTAGTGG + Intronic
1077813808 11:5665885-5665907 CAGTTTCCAAATATGGATAGAGG - Intronic
1078235723 11:9482746-9482768 TAACAGCCACATATGGCTAGTGG - Intronic
1078518599 11:12045972-12045994 AAATAGCCACATGTGGCTAGTGG + Intergenic
1078935832 11:15949140-15949162 AAATAGCCACATGAGGCTAGTGG - Intergenic
1078935836 11:15949231-15949253 CAATAGCCACATGTGGCTAGAGG + Intergenic
1079287283 11:19147700-19147722 AAATAGCCACATATAGCTAGTGG + Intronic
1079498388 11:21072852-21072874 AAATGTACACATATGGCTAATGG - Intronic
1079534086 11:21489974-21489996 AAATATCCACATCAGAAGAGAGG + Intronic
1079634692 11:22721599-22721621 AAATAGCCACATGTGGATAGTGG - Intronic
1079690825 11:23414694-23414716 TAATGTCCCCATAGGGATAGTGG + Intergenic
1080400600 11:31931735-31931757 AAATAGCCACATGTAGCTAGTGG + Intronic
1080655520 11:34254993-34255015 AAATAGCCACATATGGTTAGTGG + Intronic
1080792121 11:35530751-35530773 AAAGATCCCCATATGGATCAAGG + Intergenic
1080889292 11:36395453-36395475 CAATAGCCATATATGGCTAGTGG + Intronic
1081824362 11:46033670-46033692 CAATAGCCATATATGGCTAGTGG - Intronic
1082016765 11:47494805-47494827 AAATAGCCACTTGTGGCTAGTGG - Intronic
1083194541 11:61077036-61077058 AAATAGCCACATGTGGCTAGTGG - Intergenic
1084841194 11:71850415-71850437 AGATATCAACATATGCATAATGG - Intergenic
1085487296 11:76876159-76876181 AAAGTTCCACATCTTGATAGAGG - Intronic
1085544751 11:77307158-77307180 TAATAGCCACATGTGGCTAGTGG + Intergenic
1085743159 11:79094018-79094040 CAATAGCCACATGTGGCTAGTGG + Intronic
1086578354 11:88366621-88366643 AAATAGCTACATATGGCTAGTGG + Intergenic
1087023780 11:93629503-93629525 CTATATCCACATGTGGCTAGTGG - Intergenic
1087023785 11:93629602-93629624 AAATAACCACATGTGGCTAGTGG + Intergenic
1088091152 11:106041431-106041453 CAATAGCCACATGTGGCTAGTGG - Intergenic
1088128783 11:106461923-106461945 AAATAGCCACATGTGGCTAGTGG + Intergenic
1088212216 11:107469319-107469341 AAATAGGCACATGTGGTTAGTGG - Intergenic
1088213161 11:107478849-107478871 AAATAGCTACATGTGGCTAGTGG + Intergenic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1088246667 11:107825202-107825224 AAATAACCACATGTGGCTGGGGG + Intronic
1088383976 11:109231259-109231281 TAGTATTCACATATGGATAGGGG + Intergenic
1089427301 11:118389276-118389298 TAATAGCCACATATGGCCAGTGG + Intronic
1089800059 11:121020527-121020549 AAATAGCCACATGTGGCTAGTGG + Intergenic
1089909965 11:122088205-122088227 AAATAGCCACATATGATGAGTGG + Intergenic
1090004200 11:122985454-122985476 CAATAGCCACATAGGGCTAGTGG + Intergenic
1090331389 11:125935166-125935188 AAATAACCACATGTGGCTAGAGG + Intergenic
1090394982 11:126413062-126413084 AAATAGCCACATGTGCCTAGCGG - Intronic
1090552338 11:127836434-127836456 AAATATACAAATATGGAAGGTGG + Intergenic
1090694387 11:129223208-129223230 CAATAACCACATATGGCTAGTGG + Intronic
1091235602 11:134020297-134020319 AAATCTCCCCAGATGGATGGTGG - Intergenic
1091561301 12:1615978-1616000 AAATAGCCACATGTGGTCAGTGG + Intronic
1091571977 12:1694947-1694969 AAATAACAACATATTGATATGGG - Intronic
1091585445 12:1813546-1813568 AAATAGCCACGTATGGTTGGTGG + Intronic
1091662082 12:2391810-2391832 AAATAGCCACACTTGGTTAGTGG - Intronic
1091946944 12:4554852-4554874 ATATAGCCACACATGGCTAGAGG - Intronic
1091984392 12:4896406-4896428 AAATAGCCACATGTTGCTAGGGG + Intergenic
1092227920 12:6760649-6760671 AAATAGCCACATGTGGCTAGTGG - Intronic
1092982874 12:13814813-13814835 AAATAGCCACATTTGGCTAGTGG + Intronic
1093449853 12:19302738-19302760 AAATAGCCACATGTTGCTAGTGG - Intronic
1094506600 12:31067078-31067100 AAATATCCACATTTGAAGATGGG - Intergenic
1094551858 12:31460059-31460081 AAATCTCCAAGTATGGCTAGGGG - Intronic
1095420189 12:42017341-42017363 ACATATCCACATCAGAATAGGGG - Intergenic
1095460256 12:42436005-42436027 ATATAGTCACATATGGCTAGTGG + Intronic
1095904045 12:47359002-47359024 AAATAGCCACGTATGGCTAGTGG + Intergenic
1096812104 12:54177517-54177539 AAACAGCCACACATGGCTAGTGG + Intronic
1096823556 12:54256573-54256595 AAATAGGCACATGTGGCTAGTGG - Intronic
1096945117 12:55397313-55397335 ATATATACACATATGTATATAGG + Intergenic
1097210760 12:57367382-57367404 AAATATCCACATGTAGCTAGTGG + Intronic
1097322189 12:58238201-58238223 ATATATATACATATGGAAAGAGG - Intergenic
1097362996 12:58679268-58679290 AAATATCAACATAAAGATACAGG - Intronic
1097688697 12:62714249-62714271 AAATGGCCACATGTGGCTAGTGG + Intronic
1097815228 12:64066683-64066705 AAATATACACATTTGAATAAGGG - Intronic
1097936037 12:65252532-65252554 CAATAGCCACATATAGACAGTGG + Intergenic
1098014164 12:66086830-66086852 AAATATCCACACAGAGACAGTGG + Intergenic
1098036162 12:66303913-66303935 AAACAGCTACATATGGCTAGTGG - Intronic
1098379876 12:69856468-69856490 AAATATCCACATTTTTAGAGTGG + Intronic
1098575920 12:72042309-72042331 AAATATCCTAATATGGGAAGGGG + Intronic
1098930667 12:76408635-76408657 CAGTAACCACATATGGCTAGTGG - Intronic
1099113783 12:78597297-78597319 AAATAGCCACATGTGCCTAGTGG - Intergenic
1099368357 12:81798089-81798111 AAATAGTCACATGTGGCTAGTGG + Intergenic
1100071497 12:90725179-90725201 AAATATCCACATGTGGTTAAAGG + Intergenic
1100195777 12:92242618-92242640 AAATAACCACATGTGGTTAGTGG - Intergenic
1100451903 12:94714940-94714962 AAATATGCACATATGCACATTGG + Intergenic
1100543004 12:95575741-95575763 AAATACCCACATATGGCTAGTGG - Intergenic
1100546758 12:95610703-95610725 AAATATCAACATATGGTGGGAGG - Intergenic
1100697687 12:97113377-97113399 AAATAGCCACATGTAGCTAGTGG - Intergenic
1101115970 12:101531658-101531680 AAATATCCATATGTGGCTAGTGG + Intergenic
1101315614 12:103626292-103626314 AAATAGCCACATGTGGCTCGTGG + Intronic
1101588093 12:106102497-106102519 AAATATCCACCTGTGGCTAGTGG + Intronic
1101747627 12:107555639-107555661 AAATAGCCACACACGGTTAGTGG - Intronic
1101859632 12:108472521-108472543 AAATAGCCCCATGTGGCTAGTGG + Intergenic
1101931519 12:109017951-109017973 AAATAGCCACATGTAGCTAGTGG + Intronic
1101974862 12:109348381-109348403 AAATAGCCACATGTGGCTAGTGG + Intronic
1102133964 12:110557143-110557165 CAATAGCCACATGTGGCTAGTGG - Intronic
1102761189 12:115386833-115386855 AAATAGCCATATGTGGCTAGTGG + Intergenic
1102849717 12:116229133-116229155 AAATATACACAAATGGTGAGGGG + Intronic
1102881625 12:116489581-116489603 AAACATCCAAATATGGGTCGTGG - Intergenic
1103013835 12:117478787-117478809 ACATAGCCACATCTGGCTAGTGG + Intronic
1103196774 12:119050799-119050821 AAATAGCCACAGATGGCTAGTGG - Intronic
1103403184 12:120657104-120657126 CAATAGCCACATGTGGCTAGTGG - Intronic
1103403191 12:120657197-120657219 ACATAGCCACATGTGGCTAGCGG + Intronic
1103406042 12:120676150-120676172 AAATAGTCACATATGGCTAGTGG - Intergenic
1103468828 12:121163783-121163805 AAATAGCCACACATGTCTAGTGG + Intronic
1103584800 12:121944370-121944392 AAATAGCCACATATGGTTGGTGG - Intronic
1104014957 12:124955744-124955766 AAACAGCCACATGTGGCTAGTGG - Intronic
1104362463 12:128146861-128146883 AAATAGCCACAAGTGGCTAGTGG - Intergenic
1104514105 12:129407920-129407942 AAATGACCACAGATGGACAGTGG + Intronic
1105401626 13:20101164-20101186 AAAAATCTGCAGATGGATAGTGG + Intergenic
1105757398 13:23480842-23480864 ATATATCAACATATGCATAATGG - Intergenic
1106121894 13:26866789-26866811 CAATACCCACCTATGGCTAGTGG - Intergenic
1106453640 13:29907929-29907951 AAATATCCAAATAAGGATGGAGG - Intergenic
1106526517 13:30545608-30545630 AAATAGCCACATATGGCTAGTGG - Intronic
1106814674 13:33394304-33394326 AAATAGCTACATGTGGACAGTGG - Intergenic
1106937257 13:34736822-34736844 AAATAGCCACATTTGTCTAGTGG + Intergenic
1106987340 13:35371688-35371710 AGATATCAACATAAGGATATAGG - Intronic
1107258396 13:38459535-38459557 AAATATCTACATATTCATATGGG + Intergenic
1107340674 13:39401987-39402009 CAATATCCACATGTGGTTAGTGG - Intronic
1107437549 13:40393591-40393613 AAATATACACATATGCAAACCGG + Intergenic
1107609753 13:42101395-42101417 AAATAGCCACATGTAGCTAGTGG - Intronic
1107613843 13:42144022-42144044 TAATATCCAGATATTTATAGTGG - Intronic
1107798124 13:44075823-44075845 CAGTAGCCACATATGGCTAGTGG - Intergenic
1107858653 13:44639960-44639982 CAATAGCCACATGTGGTTAGTGG - Intergenic
1108086808 13:46802166-46802188 AAATTTCCACATATGAATTTTGG - Intergenic
1108121991 13:47198266-47198288 AAATATGTACATATGGTGAGGGG - Intergenic
1108374821 13:49804188-49804210 AAATAGCCACATGTAGCTAGTGG - Intergenic
1108725552 13:53176553-53176575 AAATATCAACATATGAATTTTGG + Intergenic
1108728601 13:53208195-53208217 AAACAGCCACATGTGGCTAGTGG - Intergenic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1109143986 13:58753632-58753654 AAATATCTACATGTGGTTAGTGG + Intergenic
1109213982 13:59566409-59566431 AAATAGCCACATGTGGACAATGG - Intergenic
1109251943 13:60030752-60030774 AAATAGCCACATGTGTCTAGAGG - Intronic
1109973033 13:69795253-69795275 AAATATACACAGATTGATGGGGG - Intronic
1110148192 13:72220347-72220369 AGATATCAACATAAGGATACAGG - Intergenic
1110424563 13:75352287-75352309 AAATATTAGCATATTGATAGAGG - Intronic
1110557693 13:76878773-76878795 AGATATGTACCTATGGATAGGGG - Intergenic
1110607973 13:77455273-77455295 CAACAGCCACATGTGGATAGTGG + Intergenic
1111342508 13:86905788-86905810 AAATCTGCACATATGCATAGGGG + Intergenic
1111395669 13:87665805-87665827 AAATAGCCACCTGTGGCTAGTGG - Intergenic
1111882781 13:93979226-93979248 AAATAGCCACATTTGGCTGGTGG + Intronic
1111971402 13:94920846-94920868 AAATAGCCACATGTGGCTAGTGG + Intergenic
1112623143 13:101072862-101072884 CCATAACCACATATGGCTAGTGG + Intronic
1112714662 13:102169949-102169971 AAATAGCCACATTTGGCTAGTGG + Intronic
1112982383 13:105401105-105401127 AAATACACACATATCAATAGTGG + Intergenic
1113554087 13:111217262-111217284 AAAAATCCACTAATGGAGAGTGG + Intronic
1113625558 13:111844131-111844153 AAAAAGCCACATGTGGCTAGTGG - Intergenic
1113659041 13:112091713-112091735 AAATAACCACATGGGGCTAGTGG + Intergenic
1114064247 14:19047340-19047362 CAATAGCCACATGTGGCTAGTGG + Intergenic
1114098012 14:19352658-19352680 CAATAGCCACATGTGGCTAGTGG - Intergenic
1114185001 14:20394406-20394428 AAATAGCCACATGTGGCTAGTGG + Intronic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114419320 14:22567682-22567704 CAATAACCACATGTGGCTAGTGG + Intronic
1114754019 14:25238152-25238174 AAATAACCACATGGGGTTAGGGG - Intergenic
1115195816 14:30798291-30798313 AAATGGCCACATGTGGCTAGTGG + Intergenic
1115606383 14:35006383-35006405 CAATAACCACATGTGGCTAGTGG - Intronic
1116130570 14:40850939-40850961 TAATATCCACATATTGCTAGTGG - Intergenic
1116411429 14:44627962-44627984 TAATAGCCACATGTGGCTAGTGG - Intergenic
1116615984 14:47139896-47139918 ATATATACACATATGGAGAGAGG + Intronic
1116920933 14:50573450-50573472 AAATAGTCACATATGGCTACTGG + Intronic
1117323592 14:54648069-54648091 CAATAGCCACATGTGGACAGTGG + Intronic
1117658500 14:57980825-57980847 AAATAGCTACATGTGGCTAGTGG + Intronic
1117982941 14:61359745-61359767 AAATAGCCACATATGGCTAGTGG - Intronic
1117998494 14:61500722-61500744 AAATATCCACCTTTGCAGAGTGG - Intronic
1118453203 14:65922899-65922921 AAATATCCACATGTGACTAGTGG - Intergenic
1118729603 14:68657092-68657114 CAATAGTCACATATGGCTAGTGG - Intronic
1119010897 14:70987387-70987409 AAATAGCCACATATGGCTAATGG + Intronic
1119167639 14:72508323-72508345 AAATAGCTACATGTGGCTAGTGG - Intronic
1119278757 14:73385472-73385494 AAATAGCTACATATGGCTAGTGG + Intronic
1119279024 14:73387780-73387802 AAATAGCTACATATGACTAGTGG - Intronic
1119585479 14:75830980-75831002 AAATATACACATGTGGCTCGTGG - Intronic
1120099382 14:80426654-80426676 AAATAGCCACATGTGACTAGTGG - Intergenic
1120191120 14:81440660-81440682 AAATAGCCACATGTGGTTAGAGG + Intergenic
1120627820 14:86850796-86850818 AAATAGCCACATGTGGCTAGTGG - Intergenic
1120895777 14:89530579-89530601 ATATATATACATATGGAGAGAGG - Intronic
1120981554 14:90293575-90293597 AAATAGCCACATGTGGCTAGAGG + Intronic
1121184677 14:91956258-91956280 AAATAACCACATGTGGCTGGTGG + Intergenic
1121217627 14:92260808-92260830 AAATAGCCACACATGACTAGTGG - Intergenic
1121256462 14:92533915-92533937 TAATAACCACATATGGCTTGTGG + Intronic
1121463530 14:94100002-94100024 AAATAGCCACACATAGCTAGTGG + Intronic
1121478394 14:94236612-94236634 AAATAGCCACATGTGACTAGGGG - Intronic
1121672945 14:95726900-95726922 CAATAGCCACATATGGACAATGG - Intergenic
1122333379 14:100945169-100945191 AAATAGCCACATGTGGATAGAGG - Intergenic
1122958606 14:105084167-105084189 AAAGATGGACAAATGGATAGAGG - Intergenic
1123492368 15:20791831-20791853 CAATAGCCACATGTGGCTAGTGG - Intergenic
1123548870 15:21360918-21360940 CAATAGCCACATGTGGCTAGTGG - Intergenic
1124112929 15:26808664-26808686 AAATAGCCACATGTGGCTTGGGG - Intronic
1125259643 15:37808603-37808625 AAATGGCCACATGTGGCTAGTGG + Intergenic
1125300180 15:38246587-38246609 AAACAGCCACATATGGCTAGTGG + Intergenic
1125649611 15:41304743-41304765 AAATAACTAGATATGGATATGGG + Intergenic
1126209360 15:46082342-46082364 TAATAGCCACATGTGGCTAGTGG + Intergenic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1126501434 15:49350299-49350321 AAATGACCACACATGGCTAGTGG + Intronic
1126969285 15:54091681-54091703 AAATATTCAGACATTGATAGTGG - Intronic
1126990349 15:54367913-54367935 AAATAGTCACATTTGGCTAGTGG + Intronic
1127159836 15:56170629-56170651 AAATAGCCACATGTGGCTAGTGG - Intronic
1127202354 15:56669501-56669523 CAATAACCACATGTGGCTAGTGG - Intronic
1127370721 15:58337092-58337114 CAATAGCCACATGTGGCTAGTGG + Intronic
1127397058 15:58551379-58551401 AAATAGCCACATATGGTTTGTGG - Intronic
1127582015 15:60347188-60347210 AAATAGCGACACTTGGATAGGGG + Intronic
1127640991 15:60915663-60915685 AAATAGCCACATGTGGCTATTGG + Intronic
1127859888 15:62985192-62985214 AAATAGCCACGTGTGGCTAGTGG + Intergenic
1128077163 15:64834668-64834690 AAATAGCCACATGTGGCTAGTGG - Intergenic
1128676896 15:69616194-69616216 AAATAGCCACACATAGCTAGTGG - Intergenic
1128846281 15:70898881-70898903 AAATATCCACATATATATGTGGG - Intronic
1128846284 15:70898909-70898931 AAATATCCACATATATATGTGGG - Intronic
1128945888 15:71820512-71820534 AAATATCCCCTTGTGGGTAGAGG - Intergenic
1129155537 15:73715021-73715043 AAATAGCCACCTATGCATAGTGG + Intergenic
1129222883 15:74143409-74143431 AAATAACCACATGTGGCTAGTGG - Intergenic
1129813550 15:78531188-78531210 AAATAGCCACATATGTCTAGTGG + Intronic
1130334815 15:82949744-82949766 AAATAGCCACATGTAGCTAGTGG - Intronic
1130368113 15:83258751-83258773 CAGTATCCATATATGGCTAGTGG - Intronic
1131133507 15:89914826-89914848 AAGTAGCCACATGTGGCTAGTGG - Intergenic
1131242924 15:90763531-90763553 ATATATGCATATATGCATAGTGG + Intronic
1131347055 15:91659813-91659835 AAATAGCCACACGTGGATAGTGG - Intergenic
1131377316 15:91936330-91936352 AAATAGCCATATGTGGTTAGTGG - Intronic
1202957206 15_KI270727v1_random:88152-88174 CAATAGCCACATGTGGCTAGTGG - Intergenic
1133313043 16:4863449-4863471 AAATATCCACATGTGGCTTTTGG - Intronic
1133657902 16:7884383-7884405 AAATAGCCACATGTGACTAGTGG + Intergenic
1133894172 16:9909546-9909568 AAATAGCCACATATGGCTAGTGG + Intronic
1133930370 16:10227382-10227404 CAATAGCCCCATATGGCTAGTGG + Intergenic
1134156237 16:11845542-11845564 AAATAGGCACATGTGGCTAGTGG - Intronic
1135115540 16:19719995-19720017 AAATAGCCACATTTGGATAGTGG + Intronic
1135612906 16:23884104-23884126 CAGTAGCCACATATGGCTAGTGG + Intronic
1135835096 16:25818177-25818199 AAATTTCAACATATGGATTTTGG - Intronic
1137484032 16:48876828-48876850 CAATAGCCACATGTGGTTAGTGG - Intergenic
1137627283 16:49917254-49917276 AAATATCCACACATGTACTGAGG + Intergenic
1138051278 16:53781290-53781312 AAAGATCCACTTATGTATTGTGG - Intronic
1138909122 16:61375142-61375164 AAATACGCACATATGGGCAGGGG - Intergenic
1138941625 16:61798444-61798466 AAATAGCCACATATAGTTAGTGG - Intronic
1139498463 16:67339716-67339738 AAAGGTCCAGATATGAATAGGGG - Intronic
1139620813 16:68140427-68140449 AAATATCCACGTGTAGCTAGTGG - Intronic
1139786915 16:69400707-69400729 AAATAGCCACTTGTGGCTAGTGG + Intronic
1140156728 16:72436622-72436644 AAATAGTCACATGTGGCTAGGGG + Intergenic
1140203218 16:72911632-72911654 AAATAGTCACATGTGGCTAGTGG - Intronic
1140298071 16:73727936-73727958 AAATAGCCACATGTAGCTAGTGG - Intergenic
1140837384 16:78807785-78807807 AAATAGCCACATGTGGCTAATGG - Intronic
1141338191 16:83177139-83177161 TAATAGCCACATGTGGCTAGTGG + Intronic
1141758425 16:86010692-86010714 CAATATCCTCATATGCAAAGTGG - Intergenic
1142278241 16:89134049-89134071 ATATTTCGACATTTGGATAGTGG + Intronic
1142776194 17:2141064-2141086 AAATATCCACATGTGGCTAGTGG - Intronic
1142865423 17:2788204-2788226 AAATATATACATATGTATATAGG + Intronic
1143153978 17:4824085-4824107 AAATAGCCAAACATGGCTAGTGG - Intergenic
1143911141 17:10250646-10250668 AAATAACCACATGTGGCTTGTGG + Intergenic
1144102293 17:11952498-11952520 AAATAGCCACATGTGGCTAGTGG + Intronic
1144153164 17:12470899-12470921 AAATACCCACATGTAGGTAGTGG + Intergenic
1144692016 17:17273259-17273281 AAATAGCTGCATATGGCTAGTGG - Intronic
1145977264 17:28991517-28991539 AAATAGCCACATGTGGTCAGTGG + Intronic
1146466704 17:33091952-33091974 AAATAGCCCCATGTGGCTAGTGG + Intronic
1146782742 17:35689690-35689712 ACATAGCCACATGTGGCTAGTGG - Intronic
1147015360 17:37487848-37487870 AGATAGCCACATGTGGCTAGTGG - Intergenic
1147398781 17:40166095-40166117 AAGTGTCCACATTTGGTTAGTGG + Intronic
1147464671 17:40601892-40601914 AAATAGCCACGTGTGGCTAGTGG - Intergenic
1147468201 17:40629085-40629107 TAATAACCACATGTGGCTAGTGG - Intronic
1147863884 17:43540676-43540698 AAATAGGCACATTTGGATAGAGG + Intronic
1148136408 17:45294825-45294847 AAATAGCCACATGTTGCTAGTGG - Intronic
1148168279 17:45499377-45499399 AAATAGCCATATGTGGCTAGTGG + Intergenic
1148280535 17:46343574-46343596 AAATAGCCATATGTGGCTAGTGG - Intronic
1148302763 17:46561509-46561531 AAATAGCCATATGTGGCTAGTGG - Intronic
1148366854 17:47061841-47061863 AAATAGCCATATGTGGCTAGTGG - Intergenic
1148904288 17:50901947-50901969 AAATAGCCACATCTGGCTAGTGG + Intergenic
1149646837 17:58247324-58247346 AAATAGCCACATGTGGTTAGTGG + Intronic
1149649373 17:58267470-58267492 CAACATCGACATCTGGATAGGGG + Exonic
1149676370 17:58466649-58466671 AAATAGCCACATGTGGCTAGTGG + Intronic
1150251153 17:63705217-63705239 AAATAGCCACAAGTGGCTAGTGG - Intronic
1150399467 17:64845803-64845825 AAATAGCCATATGTGGCTAGTGG + Intergenic
1150546650 17:66165244-66165266 AAATAGCCACATGTGATTAGGGG - Intronic
1150601750 17:66657124-66657146 AAATATCCCCATTTGAATAGGGG + Intronic
1150748291 17:67834888-67834910 AACTCTCCACATGTGGCTAGTGG - Intronic
1151111002 17:71677796-71677818 CAGTAGCCACATATGGCTAGCGG + Intergenic
1151301203 17:73228030-73228052 AAATAACCATATGTGGCTAGTGG - Intronic
1151376110 17:73690227-73690249 AAATACCCCCATATGGCCAGCGG + Intergenic
1151912280 17:77091603-77091625 AAATAGTCACATGTGGCTAGTGG + Intronic
1152920435 17:83063943-83063965 AAAAATCCACATTTGGATTTCGG + Intergenic
1153329911 18:3863189-3863211 ACAGATCCACATGTGGCTAGTGG + Intronic
1153404200 18:4717587-4717609 AAATTACCACATATGGCTAATGG - Intergenic
1153545335 18:6199306-6199328 AAATAGCCACATATGGGCAGTGG - Intronic
1153633782 18:7096678-7096700 ATATATACACATATGGAATGGGG - Intronic
1153678809 18:7480596-7480618 GAAAATCCACATGTGGCTAGTGG - Intergenic
1153948831 18:10040038-10040060 AAATAGCCACATGTGACTAGTGG - Intergenic
1153975976 18:10268713-10268735 AATTAGCCACATGTGGCTAGTGG + Intergenic
1154449911 18:14466388-14466410 CAATAGCCACATGTGGCTAGTGG - Intergenic
1154955338 18:21248730-21248752 AAATAGCCACATGTGGCTAGAGG - Intronic
1155194971 18:23465672-23465694 AAATATCCAAGTGTGGCTAGTGG + Intronic
1155297663 18:24399993-24400015 CAATAGCCACATGTGGCTAGTGG - Intergenic
1155895160 18:31316105-31316127 AAATAACCACATGTGGCTAGTGG - Intergenic
1156123371 18:33872751-33872773 CAATAGCCACATATGGATAGTGG + Intronic
1156582734 18:38395998-38396020 AAATAGACACATATATATAGAGG - Intergenic
1157120192 18:44902025-44902047 AAATAGCCACATGTGGCTACTGG - Intronic
1157250417 18:46090710-46090732 AAATAGCCACATGTGGTTAGTGG - Intronic
1157266449 18:46227565-46227587 AAATATATACATATGACTAGAGG + Intronic
1157321839 18:46640723-46640745 TAATAGCCACATATGGTCAGGGG + Intronic
1157670986 18:49528452-49528474 AAATATGCACATATACATAATGG - Intergenic
1157852286 18:51066679-51066701 AAATAGTCACATGTGGCTAGTGG + Intronic
1158287723 18:55903360-55903382 AAATAGCCTCATATGGCTAATGG + Intergenic
1158625495 18:59067903-59067925 AAATAGCCACAAGTGGCTAGGGG + Intergenic
1158926832 18:62273731-62273753 AAGTAGCCACATGTGGCTAGTGG + Intronic
1158949597 18:62480934-62480956 AAATATCCTCAAATAGATAAAGG + Intergenic
1159016906 18:63108372-63108394 AAATAGCCACATGTGGCTAGTGG - Intergenic
1159170499 18:64760068-64760090 AAATAACCACATATTGATAGTGG + Intergenic
1159391954 18:67805003-67805025 ATATAACCACATATGTCTAGAGG + Intergenic
1159460462 18:68716445-68716467 CAATAGCCACATGTGGTTAGTGG - Intronic
1159537916 18:69738314-69738336 AAATATTAACATATTGATATTGG + Intronic
1160269290 18:77369676-77369698 AAATATCCTCAAATGTCTAGGGG - Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1162518257 19:11163199-11163221 AAATAGCCACATGTAGCTAGCGG + Intergenic
1162963432 19:14142854-14142876 AAATAGCCACATGTGGCTAGTGG - Intergenic
1163812593 19:19443091-19443113 AAATAGCCACATGTGGCTAATGG + Intronic
1164092797 19:21974975-21974997 AATTATCCACATATGTATTTCGG - Intronic
1164499536 19:28805605-28805627 ATATATACACATATGTATATAGG + Intergenic
1164817921 19:31220598-31220620 AAATAGCAACATATGATTAGTGG + Intergenic
1164924004 19:32112094-32112116 AAATAGCCACTCATGGTTAGTGG - Intergenic
1165545305 19:36530076-36530098 ATATATCTACATATGTATATAGG - Intergenic
1165989580 19:39802032-39802054 CAATAGCCACATGTGGCTAGTGG - Intergenic
1166049991 19:40253068-40253090 AAAGAGCCACATATGGCTAGTGG - Intronic
1166808561 19:45501325-45501347 AGATATCCAAAGATGTATAGTGG + Intronic
1167155859 19:47738624-47738646 AAATAAGCACATGTGGCTAGTGG + Intronic
1167218766 19:48183454-48183476 AAATAGCCACCTATGGCTATTGG + Intronic
1167274280 19:48526976-48526998 CAATAGCCACATGTGGCTAGTGG + Intergenic
1167277565 19:48548025-48548047 AAATAGCCACCTATGGCCAGTGG + Intergenic
1167438582 19:49494879-49494901 AAATAGCCACATGTGGCTAAAGG - Intergenic
1167703058 19:51062043-51062065 AAATAGCCACATGTAGCTAGTGG - Intronic
925440146 2:3878677-3878699 AAATAGCCACATATGGCTGGTGG + Intergenic
926022423 2:9508193-9508215 AAGTAGCCACATATGGTTGGTGG - Intronic
926026457 2:9549424-9549446 ATATATACACATAAGTATAGTGG + Intronic
926278864 2:11428343-11428365 TAGTAGCCACATATGGCTAGTGG - Intergenic
926278869 2:11428447-11428469 AAATAGCCACATGTGGCTAGTGG + Intergenic
926657814 2:15428319-15428341 AAATAGCCACATGTGGCCAGTGG + Intronic
926680169 2:15657068-15657090 AAATAGCCACATATGTCTAGTGG - Intergenic
927220263 2:20700898-20700920 AAATAACCACATGTGGCTAGTGG + Intronic
927764802 2:25796817-25796839 AAATAGCCACATGAGGATAGTGG - Intronic
927773292 2:25882437-25882459 AAATTTCCAAATATGGGAAGGGG - Intergenic
928038748 2:27852322-27852344 AAATATCCACATGTGGCTAGTGG + Intronic
928164562 2:28960871-28960893 AAATAGCCACATGTAGCTAGTGG + Intronic
928347228 2:30511411-30511433 AAATAGCTACATGTGGGTAGTGG - Intronic
928376935 2:30782864-30782886 AAGTATCCACATATGGCTTGTGG - Intronic
928600926 2:32902900-32902922 CAACAACCACATATGGCTAGTGG + Intergenic
928705302 2:33943228-33943250 AAATAGCCACATGTGGGTGGTGG + Intergenic
928848731 2:35715184-35715206 AACTGTCCACAGATAGATAGAGG + Intergenic
928889476 2:36186566-36186588 AAATAGCCACCTGTGTATAGTGG - Intergenic
929073636 2:38059237-38059259 AAATAGCCACATGTGACTAGTGG + Intronic
929366615 2:41165938-41165960 ATATATATATATATGGATAGAGG + Intergenic
929616979 2:43318562-43318584 CAAGATCCACATATGACTAGTGG + Intronic
929647705 2:43645502-43645524 GAACATCCACATGTGGCTAGTGG - Intronic
929823769 2:45294010-45294032 CAATAGCCACATGTGGCTAGTGG - Intergenic
929884534 2:45866678-45866700 AAATAGCCACAGGTGGCTAGTGG - Intronic
930057230 2:47261361-47261383 AAATTGCCATATATGGCTAGTGG - Intergenic
930141435 2:47954878-47954900 AAATAACCACATGTGGCTAGTGG - Intergenic
930180395 2:48350138-48350160 ATTTATCCACATGTGGCTAGTGG + Intronic
930626742 2:53707233-53707255 AAATAGCCACATGTGGCTGGTGG + Intronic
930793788 2:55365966-55365988 AAATAGCCACATGCGGCTAGTGG + Intronic
930813959 2:55572989-55573011 ACATATTCACACATGTATAGAGG - Intronic
931039583 2:58282576-58282598 AGATATCCACAAGTTGATAGGGG - Intergenic
931217236 2:60257463-60257485 GAACATCCACATATGCAGAGTGG + Intergenic
931439670 2:62279631-62279653 AAATAGCCACATGTGACTAGTGG + Intergenic
931617854 2:64179367-64179389 AAATAGTCATATATGGCTAGTGG + Intergenic
931829187 2:66033202-66033224 AAATAACCACATATTTCTAGTGG - Intergenic
932066255 2:68564931-68564953 AAACAGCCACATGTGGCTAGTGG - Intronic
932140162 2:69269504-69269526 CAATAACCACATGTGGCTAGTGG + Intergenic
932179866 2:69637015-69637037 AAATAGCCATATGTGGCTAGTGG + Intronic
932199827 2:69815777-69815799 AAACAGCCACATGTGGTTAGTGG + Intronic
932256790 2:70294549-70294571 AAATATACATATATAGAGAGAGG - Intergenic
932383173 2:71304716-71304738 CACTTTCCACATAAGGATAGAGG + Intronic
933917064 2:87006232-87006254 CAATAGCCACATGTGGCTAGTGG - Intronic
933977579 2:87523854-87523876 AAATATCCACATGTGACTTGTGG + Intergenic
934005931 2:87763682-87763704 CAATAGCCACATGTGGCTAGTGG + Intronic
934059504 2:88281099-88281121 AAATAGCCACATGTGGCTAGTGG - Intergenic
935239350 2:101164943-101164965 AAATAGCCACACATGGCTAGTGG - Intronic
935768887 2:106397782-106397804 CAATAGCCACATGTGGCTAGTGG + Intronic
935856855 2:107283833-107283855 CAATAACCACATATGGCTAGTGG - Intergenic
935911215 2:107898142-107898164 CAATAGCCACATGTGGCTAGTGG - Intergenic
935969325 2:108514979-108515001 CAATAGCCACATGTGGCTAGTGG - Intergenic
936027052 2:109040159-109040181 AAATATCCATATGGGGAAAGAGG - Intergenic
936132988 2:109863184-109863206 CAATAGCCACATGTGGCTAGTGG - Intergenic
936211709 2:110508301-110508323 CAATAGCCACATGTGGCTAGTGG + Intergenic
936316248 2:111426952-111426974 AAATATCCACATGTGACTTGTGG - Intergenic
936420848 2:112362878-112362900 CAATAGCCACATGTGGCTAGTGG + Intergenic
936508778 2:113129187-113129209 CAATAGCCACATGTGGTTAGTGG + Intronic
936951448 2:117981808-117981830 CAATAGCCACATATGGATAGTGG + Intronic
937724943 2:125152146-125152168 AAATAGCAAAATATGGATACAGG - Intergenic
937969520 2:127538430-127538452 AAATAGCCACATGTGGCTAGTGG + Intronic
938324101 2:130386118-130386140 AAATAGCCACACATGGCTAGTGG - Intergenic
938481514 2:131666371-131666393 CAATAGCCACATGTGGCTAGTGG + Intergenic
938656091 2:133435722-133435744 AGATATCCACATGTGGCTAGTGG + Intronic
938704392 2:133909773-133909795 GAATATCCACATATAGCCAGTGG + Intergenic
939132020 2:138246812-138246834 AAATAGCTACATGTGGCTAGTGG + Intergenic
939132356 2:138251615-138251637 AAATAGCTACATGTGGCTAGTGG - Intergenic
939253209 2:139710271-139710293 AAATAGCCGCATGTGGCTAGTGG + Intergenic
939414025 2:141869290-141869312 AAATAACCCCATGTGGCTAGTGG + Intronic
939457468 2:142455863-142455885 CAATAGCCACATGTGGCTAGTGG - Intergenic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940751520 2:157631020-157631042 CAATATTCACATGTGGCTAGTGG - Intergenic
940858006 2:158744857-158744879 AAATAGCCACATATGGCCAGTGG + Intergenic
940959630 2:159769972-159769994 AAATAGCCTCATGTGGCTAGTGG + Exonic
941055587 2:160784300-160784322 GAATATCCACATGTGGCTAGTGG - Intergenic
941291180 2:163677524-163677546 AAATAGCCACATGAGGCTAGTGG + Intronic
941614674 2:167705803-167705825 AAATAGCCACATGTGGTTAGTGG - Intergenic
941664837 2:168234385-168234407 AAATAGCCACATATGGTTAGTGG + Intronic
941764617 2:169283456-169283478 CAATAGCCACATATGACTAGTGG + Intronic
941903677 2:170701178-170701200 AAATAGCCACATGTGGCTACTGG + Intergenic
941947967 2:171121125-171121147 AAATTTCTACAGATGAATAGTGG + Intronic
942503390 2:176616046-176616068 CAATAGCCACATGTGGCTAGTGG - Intergenic
942858535 2:180581957-180581979 CAATAAGCACATATGGCTAGTGG + Intergenic
942874195 2:180773616-180773638 AAATATCCACATGTGGCTAGTGG + Intergenic
942916276 2:181311671-181311693 CAATAGTCACATATGGACAGTGG - Intergenic
943601632 2:189927789-189927811 AAATAGCCACATATGGCTAGTGG - Intronic
943631253 2:190254877-190254899 TAATAGCTACATATGGCTAGTGG - Intronic
943966104 2:194334755-194334777 AAATCTCCACATATGGTTTGTGG - Intergenic
944054101 2:195504918-195504940 AAATAGCCATGTATGGCTAGTGG + Intergenic
944396883 2:199278320-199278342 AAATACCCACATGTGGCTAGTGG - Intronic
944655630 2:201874137-201874159 AAATAGCCACATGTGGCTAATGG - Intronic
944975899 2:205050489-205050511 CAATAGCCACATGTGGCTAGTGG - Intronic
945022829 2:205591338-205591360 AAATATTCAAATATGTTTAGAGG - Intronic
945237366 2:207643800-207643822 AATTAACCACATATGCATAATGG + Intergenic
945262885 2:207861115-207861137 AAATATCCTCAAAAGGGTAGAGG + Exonic
945443060 2:209903665-209903687 ATATATACACACATGGTTAGAGG + Intronic
945491371 2:210459545-210459567 CAATAGCCACATGTGGCTAGTGG + Intronic
945505535 2:210635592-210635614 AAATAACCACATGTGGCTAGGGG + Intronic
945956487 2:216091169-216091191 AAATTTCAACATATGGATTTGGG - Intronic
946060311 2:216935507-216935529 AAATAGCCACATGTGGCTGGTGG + Intergenic
946079000 2:217100497-217100519 AGATAGCCACATATGGCTATTGG - Intergenic
946234023 2:218311263-218311285 AAATATCCACAGGTGCGTAGGGG - Intronic
946475544 2:220003365-220003387 AAATAGCCACATGTAGCTAGGGG + Intergenic
946534784 2:220615085-220615107 AAAAAGCCACATGTGGTTAGTGG - Intergenic
946614612 2:221496290-221496312 CAATAGCCATATATGGCTAGTGG - Intronic
946745909 2:222845705-222845727 CAATCACCACATATGGCTAGGGG - Intergenic
946883888 2:224203745-224203767 CAATAGCCACATGTGGCTAGAGG + Intergenic
947029218 2:225773783-225773805 CAATAGCCACATGTGGCTAGTGG + Intergenic
947085271 2:226444185-226444207 AAATAGCCACATGTGGCTGGTGG + Intergenic
947688377 2:232111661-232111683 AAATAGCTACATGTGGTTAGTGG + Intronic
947702238 2:232244141-232244163 ACATATCCACACTTGAATAGTGG + Intronic
947860186 2:233353152-233353174 AAGTAGCCACATGTGGCTAGTGG + Intergenic
948307399 2:236959508-236959530 TAATAGCCACATGTGGCTAGAGG + Intergenic
1168985285 20:2043089-2043111 CAATAGCCACATGTGGGTAGTGG - Intergenic
1169055629 20:2618363-2618385 AAATAACCACACATGGCTAATGG + Intronic
1169140081 20:3222850-3222872 AAATAGCCACACCTGGCTAGTGG + Intronic
1169322997 20:4650582-4650604 CAGTAACCACATATGGCTAGTGG - Intergenic
1169495248 20:6109058-6109080 AGATATCCACATGTGGCTAGGGG + Intronic
1169513908 20:6295918-6295940 AAATAGCCACATGTGGCTAGTGG - Intergenic
1169698110 20:8414798-8414820 AAATAGCCACATGTGGCTAGTGG + Intronic
1169812480 20:9622282-9622304 AAATAGTCACATATGTCTAGTGG - Intronic
1169921055 20:10734588-10734610 GAATAGCCACATGTGGCTAGTGG - Intergenic
1169926608 20:10790807-10790829 AAATAGACACATGTGGCTAGTGG + Intergenic
1169930423 20:10826977-10826999 AAATATCCTTATGTGGCTAGTGG + Intergenic
1169930781 20:10830636-10830658 AAATATCCATACATGGATGAAGG + Intergenic
1169932541 20:10850262-10850284 CAATAGCCACATGTGGCTAGTGG + Intergenic
1170127739 20:12984814-12984836 AAATAGCCACTTGTGGCTAGTGG - Intergenic
1170171294 20:13416059-13416081 AAATAGCCACATGTGGCTCGTGG - Intronic
1170203530 20:13770918-13770940 AAATAACCAAATATGACTAGTGG + Intronic
1170409499 20:16073393-16073415 AAATTGCCACATGTGGCTAGTGG + Intergenic
1170538017 20:17361002-17361024 AAATAGGCACATATGGCTAGTGG - Intronic
1170699567 20:18691787-18691809 AAATAGCCACACCTGGCTAGTGG + Intronic
1170937478 20:20822769-20822791 AAATAGCTACATTGGGATAGTGG + Intergenic
1171009304 20:21499561-21499583 AAATAGCCACATGTGGCCAGTGG - Intergenic
1171016352 20:21545346-21545368 AAATAGTCCCATATGGCTAGTGG - Intergenic
1172238022 20:33391425-33391447 AAATAGCCACATGTGGCTAGTGG + Intronic
1172395348 20:34599884-34599906 GAATAGCCACATATGGCTAGGGG - Intronic
1172556072 20:35842505-35842527 AAATATCCAAATATCCATAATGG - Intronic
1172742170 20:37177834-37177856 AAATATCCACATAAGGCTAGTGG + Intronic
1173200389 20:40950430-40950452 AAATAGCCACATGTGGTTGGTGG - Intergenic
1173248290 20:41350929-41350951 AAATAGCCACATATAGCCAGTGG - Intronic
1173385965 20:42588114-42588136 AAATAGCCCCATATGGTTGGTGG - Intronic
1173392368 20:42646527-42646549 AAATATCCACATATGGCCAATGG - Intronic
1173429421 20:42972967-42972989 AAATATTCACATGTGGCTGGTGG + Intronic
1173495031 20:43512593-43512615 CAATAGCCACATGTGGCTAGTGG + Intronic
1173661839 20:44739928-44739950 AAATGGCCACATATGGTTACTGG + Intergenic
1173876704 20:46376842-46376864 AAATAGCTGCATATGGCTAGTGG - Intronic
1173917217 20:46716667-46716689 AAATAACCACATATGGATGCTGG - Intronic
1174580055 20:51564910-51564932 TAATAGCCACATGTGGCTAGTGG - Intergenic
1174620538 20:51871152-51871174 AAATAGCCACATATGGCTAGTGG - Intergenic
1174622511 20:51886845-51886867 AAATTGCCACATGTGGCTAGTGG - Intergenic
1174671309 20:52310349-52310371 AAATAGCCTCATATGGCTGGTGG - Intergenic
1174725475 20:52857134-52857156 AAATGGCCACATGTGGCTAGCGG - Intergenic
1174764311 20:53237979-53238001 AAAAATATACATCTGGATAGAGG + Intronic
1175564659 20:59963631-59963653 AATTAGCCACATGTGGCTAGGGG + Intronic
1175711334 20:61223566-61223588 AAATGCCCACACATGGCTAGTGG + Intergenic
1176446263 21:6823969-6823991 CAATAGCCACATGTGGCTAGTGG + Intergenic
1176824432 21:13688999-13689021 CAATAGCCACATGTGGCTAGTGG + Intergenic
1176889386 21:14295841-14295863 TAATAACCACATCTGGCTAGTGG + Intergenic
1177060006 21:16360703-16360725 AAATATCCACATGCAGACAGTGG - Intergenic
1177134436 21:17293901-17293923 AAATAACCACATAATAATAGTGG + Intergenic
1177222465 21:18211734-18211756 CAATAGTCACATATGGTTAGTGG + Intronic
1177791493 21:25727044-25727066 CAATAGCCAGATATGGCTAGTGG - Intronic
1178783773 21:35633159-35633181 AAATAGCTACATATGGCTATTGG - Intronic
1178987716 21:37322437-37322459 AAATAAACACATGTGGCTAGTGG - Intergenic
1179505543 21:41837591-41837613 AAAGTTCCACAGATGGATGGGGG + Intronic
1180482738 22:15769966-15769988 CAATAGCCACATGTGGCTAGTGG + Intergenic
1182187742 22:28424759-28424781 AAACAGGAACATATGGATAGGGG - Intronic
1182333372 22:29567143-29567165 AAATAACTACATGTGGTTAGTGG + Intronic
1182408708 22:30162373-30162395 CAATAGCCACATGTGGCTAGTGG - Intronic
1182852552 22:33488162-33488184 AAATTGCCACATGTGGCTAGTGG - Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1183777609 22:39977198-39977220 CAATAGCCACATGTGGCTAGTGG - Intergenic
1183993250 22:41613073-41613095 AAATAGCCACATGTGGTCAGTGG - Intronic
949236624 3:1817124-1817146 AAACATCCATATATGGTTATTGG + Intergenic
949348946 3:3104391-3104413 CAATAGTCACATATGGCTAGTGG + Intronic
949444988 3:4125175-4125197 AAATATCCACATGTGGCTAGTGG - Intronic
949618188 3:5779494-5779516 AAATATCAATATATGTATATGGG - Intergenic
949902705 3:8831789-8831811 AAATAGCTACATATGACTAGTGG - Intronic
949938370 3:9135065-9135087 AAATAGCCACATGTGGCTAGTGG - Intronic
950145833 3:10649049-10649071 AAATGGCCACATGTGGCTAGTGG - Intronic
950404343 3:12795416-12795438 CAATAGCCACATGTGGCTAGTGG + Intergenic
950793075 3:15488894-15488916 AGATAGCTACATATGGCTAGTGG + Intronic
950888792 3:16384723-16384745 AAATAGCCACATGTGGCTAGTGG - Intronic
950938577 3:16869156-16869178 AACTAGCCACATGTGGCTAGTGG - Intronic
951036154 3:17934513-17934535 AAATTGCCACATATGACTAGTGG + Intronic
951041709 3:17995096-17995118 AAATAGCTACATATGACTAGTGG + Intronic
951188578 3:19742883-19742905 AAATATCCACAAATGTCTAGTGG + Intergenic
951222233 3:20080692-20080714 CAATAGCCACACATGGCTAGTGG - Intronic
951281743 3:20758807-20758829 TAATATACACATGTGGTTAGTGG + Intergenic
951372534 3:21867933-21867955 ACACAACCACATATGGGTAGTGG + Intronic
951482953 3:23181047-23181069 AAATATCCGCATGTGGCCAGTGG - Intergenic
951487456 3:23229777-23229799 CGATGTCCACATATGGCTAGTGG - Intronic
951621270 3:24604267-24604289 AAATAGCCACATTTGGCTGGTGG - Intergenic
951691909 3:25405623-25405645 AAATTGCCACATGTGGTTAGTGG - Intronic
951695565 3:25442465-25442487 CAATAGCCACACATGGCTAGTGG + Intronic
951737233 3:25881380-25881402 AAATATCCACATGGGCTTAGTGG - Intergenic
951863813 3:27284454-27284476 CAATAGCCACATGTGGCTAGTGG + Intronic
952521568 3:34163952-34163974 AAATAGCCACATGTGGCTAGTGG - Intergenic
952761229 3:36916199-36916221 ACATAGCCACATGTGGCTAGTGG + Intronic
952927351 3:38329765-38329787 CAATAGCCACATGTGGCTAGTGG - Intergenic
952927357 3:38329857-38329879 AAATGGCCACATGTGGCTAGTGG + Intergenic
953033869 3:39194679-39194701 AAATAGCCTCATTTGGCTAGTGG - Intergenic
953143978 3:40256139-40256161 AAATAGCCACATGTAGCTAGTGG + Intronic
953168298 3:40484741-40484763 AAATAGCCACATGTGGCTAGTGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953449570 3:42995035-42995057 AAATAGTCACATGTGGCTAGTGG + Intronic
953621872 3:44540034-44540056 AAATAGCCAAATGTGGCTAGTGG - Intergenic
953774393 3:45803167-45803189 CAATAGCCACATGTGGTTAGTGG + Intergenic
953789968 3:45939810-45939832 ATATAGCCACATATGGCTAGTGG - Intronic
954186367 3:48919704-48919726 AAATAACCACATGTGGCTAGTGG + Intronic
954727820 3:52630381-52630403 AAATAGCCACACATGGCTAGTGG - Intronic
955137661 3:56235798-56235820 TAATAGCCACATGTGGCTAGCGG + Intronic
955143889 3:56296852-56296874 AAATCACCACATATTGATCGTGG - Intronic
955178720 3:56644923-56644945 AAATAAAAACATATGGCTAGTGG + Intronic
955345499 3:58158264-58158286 CAATAGTCACATATGGTTAGTGG - Intronic
955545747 3:60027884-60027906 CAGTAGCCACATATGGCTAGTGG - Intronic
955621129 3:60865252-60865274 AAATAGCCACATATAATTAGTGG - Intronic
955710800 3:61777337-61777359 AAATAGCCACATGTGGCTAGTGG + Intronic
955717593 3:61846969-61846991 GAATAGCCACATGTGGCTAGTGG - Intronic
955731291 3:61990123-61990145 AAATAGTCACATGTGGCTAGTGG - Intronic
955765339 3:62338553-62338575 AAATATCCAGAGATGGATGGTGG + Intergenic
955846603 3:63169673-63169695 AAATAACCACATTTGGCAAGTGG - Intergenic
955877498 3:63508107-63508129 CAATAGCCACATGTGGCTAGTGG + Intronic
955897583 3:63716978-63717000 AAATAGCCTCATATGGGTAGTGG - Intergenic
956058436 3:65325317-65325339 AAATAGCCATATGTGGCTAGTGG - Intergenic
956075327 3:65498869-65498891 GAATAGCCACATGTGGCTAGTGG + Intronic
956109472 3:65856159-65856181 AAATAGTCACATATGGCTAATGG + Intronic
956121405 3:65969750-65969772 TAATAGCCCCATATGGCTAGTGG - Intronic
956291351 3:67663374-67663396 GAATAGCCACACATGGCTAGTGG + Intergenic
956366847 3:68513374-68513396 AAACAGCCACATATGGCTAGTGG - Intronic
956391431 3:68777402-68777424 CAGTATCCACATTTGGCTAGTGG - Intronic
956624187 3:71250448-71250470 AAATAGCCACACATGCCTAGTGG + Intronic
957181674 3:76886835-76886857 AAGTAGCCACATATAGCTAGTGG - Intronic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
958698737 3:97560492-97560514 CAATAGCCACATATGGCTGGTGG + Intronic
958879245 3:99650789-99650811 AAATAACCACATGTGGCTAATGG + Intronic
958949828 3:100404401-100404423 CAATAGCCACATGTGGCTAGTGG - Intronic
959319562 3:104853958-104853980 CAATAGCCACATATGGCTATTGG - Intergenic
959707139 3:109348590-109348612 AAATAGCCACATATGTTCAGTGG + Intergenic
959716359 3:109437700-109437722 AAAGAACCACATATGGCAAGTGG + Intergenic
960073253 3:113455401-113455423 GAATAGCCACATATAGCTAGAGG - Intronic
960326990 3:116309487-116309509 AAATAGCTACATTTGGCTAGTGG + Intronic
960402335 3:117217078-117217100 AAACAGCCACATAGGGCTAGGGG - Intergenic
960449690 3:117791151-117791173 AAATATTCCCATATGGAAATGGG - Intergenic
960490100 3:118307102-118307124 CAATAGCCACATACGGTTAGTGG - Intergenic
960624922 3:119673512-119673534 CAACAGCCACATATGGCTAGTGG + Intronic
960855660 3:122099708-122099730 AAGTAGTCACATATGGCTAGTGG - Intronic
961027761 3:123575059-123575081 AAATAGGCACATATGGCTAGTGG - Intronic
961039167 3:123664656-123664678 AAATAGCCACATGTGACTAGTGG - Intronic
961225904 3:125245623-125245645 AATTGTCCAAATATGGAGAGAGG - Intronic
961919280 3:130408921-130408943 AAATAATCACATGTGGTTAGTGG - Intronic
961919284 3:130409009-130409031 TAATAGCCACATATGGCTAATGG + Intronic
961990695 3:131187143-131187165 AAGTAACCACATGTGGCTAGTGG - Intronic
962029532 3:131584844-131584866 AAATAGCCACATGTAGCTAGTGG + Intronic
962033883 3:131630559-131630581 AAATAGCCACATATGTCTAGTGG - Intronic
962040231 3:131699372-131699394 AAATAATCACATGTGGCTAGTGG + Intronic
962110727 3:132443910-132443932 AAATAGCCACATGTAGTTAGCGG - Intronic
962166039 3:133049256-133049278 AAAAAGCCACATGTGGCTAGTGG - Intronic
962519155 3:136182268-136182290 AAATTGTCACATATGGCTAGTGG + Intronic
962692638 3:137915576-137915598 CAATAGCCACATGTGGCTAGTGG + Intergenic
962925113 3:139985943-139985965 AAATAGCCACATGTGGCTAGTGG + Intronic
963096684 3:141549598-141549620 CAATATCCACACATGGCTAGTGG - Intronic
963118203 3:141751796-141751818 CAGTAGTCACATATGGATAGTGG + Intergenic
963228244 3:142884889-142884911 CAATAGCCACATGTGGATAGTGG - Intronic
963570800 3:146993018-146993040 ATATATACATATATGTATAGAGG + Intergenic
963952217 3:151215258-151215280 CAATACCCACACATGGCTAGTGG - Intronic
964801311 3:160562156-160562178 TAATAGCCACATGTGGTTAGTGG - Intronic
964874577 3:161351933-161351955 TAATAGCCACATGTGGCTAGTGG + Intronic
965481235 3:169222070-169222092 CAATAGCCACATGTGGCTAGAGG + Intronic
965732373 3:171785798-171785820 AAATAACCACGTGTGGCTAGGGG + Intronic
965757929 3:172043250-172043272 AAATTTCCACTTGTGGCTAGTGG + Intronic
966030085 3:175335178-175335200 AAATAGCCATATATGGCTAGTGG - Intronic
966125700 3:176573812-176573834 AAATAACCACATATGATTAGTGG - Intergenic
966413894 3:179669752-179669774 AAATATGCACATGTGGCTGGTGG + Intronic
966498390 3:180607582-180607604 AACTATCCAAATATGCATACAGG - Intronic
966796008 3:183714134-183714156 AAACAGCCACATAAGGCTAGTGG + Intronic
967266672 3:187697887-187697909 AAATATCCACATATGGCTAGTGG + Intergenic
967283643 3:187847716-187847738 CAATAGCCACATATGTCTAGTGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968108767 3:196024827-196024849 AAACATACACATAGAGATAGTGG + Intergenic
969147984 4:5141063-5141085 AAATATCCACATGTGGTTAGTGG - Intronic
969313704 4:6369141-6369163 AAATAGCCACATGTGGCCAGTGG - Intronic
969382428 4:6812356-6812378 AAATAGCCACATGTGACTAGTGG + Intronic
969693147 4:8718273-8718295 AAATAACTACATGTGGTTAGTGG + Intergenic
969782291 4:9416445-9416467 AGATATCAACATATGCATAATGG - Intergenic
970570418 4:17376000-17376022 AAATATTCACATGTGGCTAGTGG + Intergenic
970860463 4:20696762-20696784 CAATAACCACAGATGGCTAGTGG - Intronic
971296995 4:25403639-25403661 AAATAGCCACATGTTGCTAGTGG - Intronic
971463574 4:26929006-26929028 CAATAGCCAAATATGGCTAGTGG - Intronic
971477523 4:27086323-27086345 AAATAGCCCCATGTGGTTAGAGG - Intergenic
972286540 4:37654182-37654204 AAATAGCTACATGTGGCTAGTGG - Intronic
972292462 4:37702641-37702663 AAATAACTACATGTGGCTAGTGG + Intergenic
972757293 4:42061325-42061347 AAATTGCCACATGTGGCTAGTGG + Intronic
972830904 4:42812517-42812539 CAATAGCCACATGTGGCTAGGGG - Intergenic
973232104 4:47852462-47852484 AAATATCCACATGTGACTAGTGG + Intronic
973325215 4:48853634-48853656 AAATAGCCACATATGGCTAGCGG - Intronic
973565959 4:52187656-52187678 AAAAATCTGAATATGGATAGAGG - Intergenic
973619977 4:52716594-52716616 CAAAATCCACATGTGGCTAGGGG + Intergenic
973644345 4:52935064-52935086 AAATAGCCACATGTGGCTAGTGG + Intronic
973813190 4:54593259-54593281 CAATAGCCACATATAGCTAGTGG - Intergenic
973813275 4:54594309-54594331 AGATATCCACAAAAGGAAAGAGG + Intergenic
974048880 4:56921310-56921332 TAATAGCCACATGTGGCTAGTGG - Intronic
974408477 4:61507810-61507832 AATGATCCACATATTGACAGAGG - Intronic
975794810 4:77996001-77996023 AAATAGCCACCTGTGGGTAGTGG + Intergenic
975802160 4:78071749-78071771 GAGTAGCCACATATAGATAGTGG + Intronic
976055731 4:81063554-81063576 AAATAGCCACCTATGGCTAGTGG - Intergenic
976091954 4:81468051-81468073 AAATATTCCCATATGACTAGTGG + Intronic
976198613 4:82558201-82558223 AAATAGCCACATGAGGCTAGTGG - Intronic
976396271 4:84559113-84559135 CAGTAGCCACATATGGTTAGTGG + Intergenic
976425479 4:84898062-84898084 AAATAGCCACATGTAGGTAGTGG - Intronic
976526453 4:86097216-86097238 GAATAACCACATGTGGCTAGTGG + Intronic
976759273 4:88530819-88530841 AGATATCAATATATGGAAAGAGG + Intronic
976980679 4:91222857-91222879 AAATAGCCACATGTGGCTGGTGG + Intronic
977270650 4:94913830-94913852 CAATAGCCACACATGGCTAGTGG - Intronic
977309681 4:95370092-95370114 CAATAGCCACATATGGCTACTGG - Intronic
977311189 4:95389493-95389515 AGATAGCCACATATAGCTAGTGG - Intronic
977387913 4:96367928-96367950 AAATGTGTACATATGGACAGAGG - Intergenic
977471182 4:97445648-97445670 AAATAGTCACATGTGGCTAGTGG + Intronic
977481368 4:97581095-97581117 AAATAGCCACAAATGGCTAGTGG - Intronic
977595043 4:98869635-98869657 AAGTAGCCACATGTGGATAGTGG + Intergenic
977650758 4:99466386-99466408 TAATAGCCACATATGGCTAGTGG + Intergenic
977658645 4:99555744-99555766 CAATAGCCACATGTGGATAGTGG + Intronic
977873701 4:102124153-102124175 CAATAGTCACATATGGCTAGTGG - Intergenic
977880518 4:102199087-102199109 ATATTTCCACATATGGATTTTGG + Intergenic
977967032 4:103164758-103164780 TAATTGCCACATATGGTTAGTGG + Intronic
978136299 4:105265304-105265326 AAACAGCCACATGTGGATAATGG + Intronic
978327019 4:107570553-107570575 ACATAGCTACATATGGCTAGGGG - Intergenic
978368773 4:108009370-108009392 AAATAGCCACATGTAGCTAGTGG + Intronic
978684203 4:111419408-111419430 AAATATCCAAATAAAAATAGAGG - Intergenic
980028181 4:127791517-127791539 TAATAACCACATATGGCTGGTGG + Intronic
980040648 4:127935831-127935853 AAATAGCCACATGTGGCTAATGG + Intronic
980411711 4:132428577-132428599 AAATAGCCACATAATAATAGTGG - Intergenic
980461322 4:133118168-133118190 AAATAGCTGCATATGGCTAGTGG + Intergenic
980520741 4:133930342-133930364 AAATAGCCACATATGGCTAGTGG - Intergenic
981467018 4:145084729-145084751 AAGTAGCCACATGTGGCTAGTGG - Intronic
981596187 4:146425503-146425525 AAATAGCCACATGTGGCTTGTGG + Intronic
981949476 4:150388896-150388918 CAATAGCCACATGTGGCTAGTGG + Intronic
982305570 4:153927135-153927157 AAATATCCTCATTTGTAAAGTGG + Intergenic
982421586 4:155205184-155205206 CAATAACCACATATGTCTAGTGG + Intergenic
982767593 4:159366204-159366226 AAATAACCAAATATAGATAGGGG + Intergenic
983249965 4:165332138-165332160 AAAAATGTACATATGGATAAAGG - Intronic
983267241 4:165521028-165521050 AAATATCAACATATGAATTTGGG - Intergenic
983528737 4:168787489-168787511 AAATAGCCACATGTGGTTAGTGG - Intronic
983693662 4:170502690-170502712 AAATATACCCATATGGATATAGG - Intergenic
983753315 4:171303200-171303222 AATTTTCTACATATGGCTAGCGG + Intergenic
983818373 4:172161282-172161304 AAATATACACATATACATAAAGG - Intronic
983923133 4:173369266-173369288 GAGTAGCCACATATGGCTAGAGG + Intergenic
984156012 4:176196880-176196902 AAATAGCCACATGTGGCTAGTGG - Intergenic
984281836 4:177679594-177679616 AAATAATTACATATCGATAGAGG + Intergenic
984365096 4:178788943-178788965 CAATAGCCACATGTGGATACCGG - Intergenic
984462184 4:180052409-180052431 AAATATCTAGAGATGGATGGTGG + Intergenic
984503553 4:180589192-180589214 AAATAGCTACATGTGGCTAGTGG + Intergenic
984791671 4:183620434-183620456 ACATAACCACATGTGGCTAGTGG - Intergenic
984791679 4:183620530-183620552 CAATAGCCACATGTGGCTAGTGG + Intergenic
985088713 4:186342117-186342139 AAATTTCCACATATGAATTTGGG + Intergenic
986153575 5:5150937-5150959 ACATATCAACATATGCATAATGG - Intronic
986361096 5:6978896-6978918 AAATAGCTACATATGGTCAGGGG - Intergenic
986418803 5:7555984-7556006 AAATAGCCACATTTGTCTAGTGG - Intronic
986757234 5:10849535-10849557 AAATATCCACATGAAGATAAAGG + Intergenic
987185164 5:15410149-15410171 AAATAGCAACATGTGGCTAGTGG - Intergenic
987639641 5:20596058-20596080 AAATATCCCCAAATGAAGAGTGG - Intergenic
988051565 5:26037618-26037640 AAATATCCAAAGATTCATAGAGG - Intergenic
988341019 5:29972070-29972092 AAATAGCCACATGTGGCTAGTGG + Intergenic
988751983 5:34196981-34197003 AAATAACCACATGTGGCTAGTGG + Intergenic
988916278 5:35896593-35896615 AAATAGCCACATGTGGCTAGTGG - Intergenic
988919019 5:35923498-35923520 AAATGTCCACCTATGGATAAAGG + Intronic
988994316 5:36700232-36700254 CAAAATCCACATGTGGCTAGTGG + Intergenic
989038897 5:37205933-37205955 AAATAGCCACATATAGTTAGTGG - Intronic
989066323 5:37466381-37466403 AAATAACCACATGTGGCTAGTGG - Intronic
989329093 5:40234748-40234770 ACACATCCATATATGGATAGTGG - Intergenic
989564420 5:42887593-42887615 AAATAGCCACATATGGCTAGGGG - Intergenic
989834904 5:45975573-45975595 AAATATCCACAGATAAATACTGG + Intergenic
990145908 5:52759982-52760004 TAATAGCCACACATGGCTAGTGG - Intergenic
990353638 5:54943311-54943333 AAATAGCCACATGTGGCTGGTGG - Intergenic
990439142 5:55826841-55826863 CAATAGCCACATGTGGCTAGTGG + Intergenic
990516225 5:56533262-56533284 AAATAGCCACGTGTGGCTAGTGG - Intronic
990519331 5:56563062-56563084 ATATATCCCCATGTGGCTAGTGG - Intronic
990686864 5:58313770-58313792 CAATAGCCACATGTGGATAATGG - Intergenic
990963508 5:61419513-61419535 AAATAGCCACATGTGGCTAGTGG - Intronic
991188268 5:63837007-63837029 AAGTAGCCACATATGGCTGGTGG + Intergenic
991349022 5:65701600-65701622 AAATAGCCACATATGGCTTATGG - Intronic
991378319 5:65989788-65989810 AAATAGCCACATGTGTCTAGTGG + Intronic
991430396 5:66538612-66538634 AAATAGCCACGTGTGGCTAGTGG + Intergenic
991449303 5:66734753-66734775 AAATAGCCACATGTGGTTGGTGG + Intronic
991618390 5:68519695-68519717 AAATAGCCATCTATGGCTAGTGG - Intergenic
991737314 5:69639765-69639787 AAATAACCACATGTGGCTAGTGG + Intergenic
991739750 5:69657797-69657819 AAATAACCACATGTGGCTAGTGG + Intergenic
991757750 5:69895381-69895403 AAATAACCACATGTGGCTAGTGG - Intergenic
991788889 5:70219491-70219513 AAATAACCACATGTGGCTAGTGG + Intergenic
991791325 5:70237538-70237560 AAATAACCACATGTGGCTAGTGG + Intergenic
991813639 5:70494597-70494619 AAATAACCACATGTGGCTAGTGG + Intergenic
991816769 5:70515881-70515903 AAATAACCACATGTGGCTAGTGG + Intergenic
991819212 5:70533922-70533944 AAATAACCACATGTGGCTAGTGG + Intergenic
991837153 5:70771263-70771285 AAATAACCACATGTGGCTAGTGG - Intergenic
991881334 5:71219855-71219877 AAATAACCACATGTGGCTAGTGG + Intergenic
991883772 5:71237880-71237902 AAATAACCACATGTGGCTAGTGG + Intergenic
992120504 5:73587391-73587413 AAATAGCCACATGTGGCTTGTGG + Intergenic
992696635 5:79295292-79295314 AAATAACCACATGTGGCTTGTGG + Intronic
992914873 5:81438973-81438995 AAATAGTCACACATGGCTAGTGG + Intronic
992968559 5:82030299-82030321 GAATAACCACATGTGGCTAGTGG - Intronic
993297918 5:86167320-86167342 AAATATTCATATATGTATACAGG + Intergenic
993345665 5:86779058-86779080 AAATAGCCACATATAGTTAGTGG + Intergenic
993520228 5:88890542-88890564 CAATAGCCACATGTGGCTAGTGG + Intronic
993679643 5:90860129-90860151 AAATACCCACATGTGACTAGTGG + Intronic
993894043 5:93509339-93509361 TAATATCCACATATCGCTAGAGG - Intergenic
994025870 5:95082786-95082808 CAATAGCCACACATGGCTAGTGG + Intronic
994085158 5:95750404-95750426 AAATAGCCACATGTAGCTAGTGG - Intronic
994254030 5:97571317-97571339 CAATCTCCACATATGGAAGGAGG - Intergenic
994366704 5:98925898-98925920 AAATAGCCACATGTGGCTAGTGG + Intronic
994384563 5:99114662-99114684 AAATAGCCACATGTGGCTAATGG + Intergenic
995723325 5:115160474-115160496 TAATAGCCACATGTGGCTAGTGG + Intronic
995732516 5:115261555-115261577 AAATAGCCAAATGTGGCTAGTGG + Intronic
996333523 5:122357731-122357753 AATTAGCCACATGTGGCTAGTGG - Intronic
996429194 5:123352502-123352524 AAACATACATATATGGACAGAGG - Intronic
997013036 5:129902570-129902592 AAATAGCCCCATGTGGCTAGGGG - Intergenic
997153083 5:131520254-131520276 TAATAACCACATACGGCTAGTGG - Intronic
997216098 5:132112114-132112136 AAATAGCCATATATGGCTAATGG + Intergenic
997330909 5:133060957-133060979 AAATAGCCACATGTGGCTAGTGG + Intronic
997338992 5:133127692-133127714 CAATAGCCACATGTGGCTAGTGG - Intergenic
998027676 5:138833340-138833362 CAATAGCCACATATGGTGAGTGG - Intronic
998028832 5:138845862-138845884 AAATATTCACATATAGATATAGG + Intronic
998293117 5:140936437-140936459 AAATAACCACATCTGTTTAGTGG + Intronic
998707608 5:144781577-144781599 CAATAACCACATGTGGCTAGTGG + Intergenic
998833708 5:146184409-146184431 AAATTGCCACATGTGGCTAGTGG - Intergenic
998837965 5:146221779-146221801 AAAGAGCTACATATGGCTAGTGG + Intronic
999331785 5:150678404-150678426 AAATATCCACATCTGTAAAGTGG - Exonic
999337072 5:150730005-150730027 AAATAACCACATGTCGCTAGTGG - Intronic
999451339 5:151680556-151680578 AAATAGCCACATGTGGCTAGTGG + Intronic
999492718 5:152067339-152067361 TAATATCCACATTTGTAAAGTGG + Intergenic
999642670 5:153687537-153687559 AAACAGCCACATACGGCTAGTGG - Intronic
999817891 5:155196128-155196150 AAATCGCCACATGTGGGTAGTGG - Intergenic
999985614 5:157002257-157002279 AAATAGCCATATATGGCTACTGG + Intergenic
1000141982 5:158414198-158414220 AAATAGCCACATATGGCTAGGGG - Intergenic
1000224594 5:159248201-159248223 CAATAGCCACATGTGGCTAGTGG - Intergenic
1000383426 5:160649683-160649705 AAATAGCTACATGTGGCTAGTGG + Intronic
1000733429 5:164866482-164866504 CAGTAACCACACATGGATAGTGG + Intergenic
1001126210 5:169021848-169021870 AAATAGCTCCATGTGGATAGAGG - Intronic
1001224275 5:169930302-169930324 AAATAACCACATATGGGTGATGG + Intronic
1001267677 5:170286601-170286623 AAGTAGCCACATGTGGTTAGAGG + Intronic
1002354287 5:178611387-178611409 AAACAGCCACATGTGGCTAGTGG - Intronic
1002670587 5:180863025-180863047 AAATAGCCACATGTGGCTAATGG + Intergenic
1003484835 6:6566662-6566684 CAATAGCCACATGTGGCTAGTGG - Intergenic
1003540841 6:7016802-7016824 AAAGACCCACTAATGGATAGAGG + Intergenic
1003626212 6:7744017-7744039 AAATTTCAACATATGGAAAAAGG + Intronic
1003898480 6:10630836-10630858 AAATAGCCACATATGACTAGTGG + Intergenic
1003957794 6:11180414-11180436 AAATAGCCACATGTGTTTAGTGG - Intergenic
1004306551 6:14506553-14506575 AAATGGCCACATATGGCTAGTGG + Intergenic
1004314927 6:14578195-14578217 AAATAGCTGCATGTGGATAGTGG - Intergenic
1004315410 6:14582599-14582621 AAATAGCCACATAGGTCTAGTGG + Intergenic
1004738249 6:18430134-18430156 AAATAGCCACATGTGGCTAGTGG - Intronic
1004968680 6:20883566-20883588 AAATAGCCGCATGTGGCTAGTGG + Intronic
1005100057 6:22161983-22162005 AAATAGCCACATGTGGCTAGTGG + Intergenic
1005396878 6:25391596-25391618 AAACAGCCACATGTGGCTAGTGG - Intronic
1005458976 6:26049498-26049520 TAATACTCACATATGGTTAGTGG - Intergenic
1005479074 6:26238263-26238285 CAGTAGCCACATATGGTTAGTGG - Intergenic
1005550145 6:26903694-26903716 AAATAACCACATGTGGCTAGTGG + Intergenic
1006211419 6:32398608-32398630 TAAAATCCTCATATGGATAAAGG - Intronic
1006292609 6:33151467-33151489 CAATAGCCACATGTGAATAGTGG + Intergenic
1006600879 6:35224980-35225002 CAATAGCCACATGTGGCTAGTGG - Intronic
1006600886 6:35225050-35225072 AAATAACCACATGTGGCTAGTGG + Intronic
1006706068 6:36022450-36022472 CAACAGCCACATATGGCTAGTGG + Intronic
1006849027 6:37083989-37084011 CAATAGCCACATGTTGATAGTGG - Intergenic
1007712649 6:43834582-43834604 AAATGGCCACATGTGGCTAGTGG + Intergenic
1007897308 6:45376394-45376416 AAATACCCACATGTGGCTAGTGG - Intronic
1007965142 6:45997661-45997683 AAATACAAACATATGAATAGTGG + Intronic
1008630259 6:53357798-53357820 ACATATACACATATGGGTATAGG + Intergenic
1008873544 6:56301672-56301694 AAATAGCCACATGTGGTTAGTGG - Intronic
1009020412 6:57942585-57942607 AAATAACCACATGTGGCTAGTGG + Intergenic
1009611272 6:65944522-65944544 AAATAGCCATATATGGCTAGTGG - Intergenic
1010766218 6:79779280-79779302 AAATAGACACATCAGGATAGGGG + Intergenic
1010885989 6:81241287-81241309 AACAATCCACATATGGAAGGAGG + Intergenic
1010993763 6:82509721-82509743 ACAGATCCACATGTGCATAGGGG - Intergenic
1011714750 6:90093575-90093597 AAATAGCCACATATTGTTAGTGG + Intronic
1011767289 6:90636031-90636053 AAATAACCTCATATTGTTAGAGG + Intergenic
1011772561 6:90691192-90691214 AAATAGCCACATGTGGTTAATGG - Intergenic
1012036142 6:94142326-94142348 ACATAAACACATATGGTTAGTGG + Intergenic
1012324608 6:97900686-97900708 AAATCTCCACATAAGGAATGGGG - Intergenic
1012393907 6:98773838-98773860 AAGTAACCACATATGACTAGTGG - Intergenic
1012449475 6:99339576-99339598 AAATATCCTCCAATGGATAAAGG + Intronic
1012903008 6:105029669-105029691 AAAGACCCACATAAGAATAGTGG + Intronic
1013372147 6:109480357-109480379 GAATAACCACATGTGGCTAGTGG - Intronic
1013448684 6:110257453-110257475 CAATAGCCATATATGGCTAGTGG + Intronic
1013731039 6:113167875-113167897 AAATAACCACACGTGGCTAGTGG - Intergenic
1013818686 6:114130123-114130145 AAATAGCCAAATATGGCTAGTGG - Intronic
1013912365 6:115292199-115292221 AAATTTCCTCATCTGGATAAAGG - Intergenic
1013937105 6:115610331-115610353 AAATAGCCACATATGTCTGGTGG + Intergenic
1013948611 6:115752607-115752629 AAAGATCCTCAGATGGTTAGTGG - Intergenic
1015071660 6:129101574-129101596 GAATTACCACATATGGCTAGTGG - Intronic
1015316764 6:131825389-131825411 AAATAGCCACATGTAGCTAGTGG - Intronic
1015331651 6:131986732-131986754 AAATATCTACATTTTGAGAGAGG + Intergenic
1015451737 6:133377391-133377413 AAATAGCCACGTGTGGTTAGTGG + Intronic
1015754990 6:136597929-136597951 TAATAGCCACATATGACTAGTGG + Intronic
1015821551 6:137266648-137266670 AAATACACACAAATGGAGAGAGG + Intergenic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1016085851 6:139913355-139913377 TAATATTCACATGTGGCTAGTGG - Intergenic
1016085855 6:139913457-139913479 AAATAGCCACATGTGGCTATTGG + Intergenic
1016224469 6:141718413-141718435 ATAGATATACATATGGATAGGGG - Intergenic
1016378314 6:143447256-143447278 AAATAGACACATGTGGTTAGTGG + Intronic
1016518241 6:144921299-144921321 AAATAGCCACATGTGGCTAGTGG + Intergenic
1016555757 6:145335544-145335566 AAATAGCTACATGTGGCTAGTGG + Intergenic
1016637561 6:146311565-146311587 AAATAGACACATGTGGCTAGTGG - Intronic
1016689498 6:146920204-146920226 AAATATACAGAGATGCATAGGGG - Intergenic
1017033409 6:150244693-150244715 AAATAGCCACATATGGTTAGTGG + Intronic
1017216369 6:151911950-151911972 AAATGGCCACATGTGGCTAGTGG - Intronic
1017245588 6:152221084-152221106 ACATATCCACATTTGGTGAGAGG - Intronic
1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG + Intergenic
1017698610 6:157044734-157044756 AAATAGCCACACATGGCTGGTGG - Intronic
1018376078 6:163214255-163214277 AAATAGCCACATGTGGCTAGTGG + Intronic
1018566105 6:165155368-165155390 AAATATCCACATGTGGCTAGTGG + Intergenic
1018789225 6:167133406-167133428 ATAGATCCACATATAGATGGCGG - Intronic
1020218028 7:6210583-6210605 AAAGTTCCACCTATGGATATAGG - Intronic
1020334883 7:7055633-7055655 AAATAGCCACATGTGGCTAGTGG + Intergenic
1020666504 7:11050524-11050546 AAATAGCCATATGTGGCTAGTGG - Intronic
1021105457 7:16634137-16634159 AAATAGCCATATGTGGCTAGTGG - Intronic
1021152123 7:17164583-17164605 AAATAGCCACATGTAGGTAGTGG - Intergenic
1021361501 7:19718588-19718610 AAATAGTCACATGTGGATAGTGG + Intergenic
1021435862 7:20614582-20614604 CAATAGCCACATATGTGTAGCGG + Intergenic
1021510976 7:21432168-21432190 AAGTAGCCACATGTGGCTAGTGG + Intronic
1022180189 7:27911579-27911601 AAGTAGCCACATATGGCTAAGGG + Intronic
1022536082 7:31099445-31099467 AAATAGCCACATATGGGTAGTGG + Intronic
1022579461 7:31535134-31535156 AAATAGCCATATATGGGTAGTGG + Intronic
1022711524 7:32855268-32855290 AAATAGCCACATGTGGCTAGTGG + Intergenic
1022913133 7:34919691-34919713 AAATAGCCACATGTGGCTAGTGG - Intergenic
1023414524 7:39919585-39919607 AAATAGCCACACATGGCTAGTGG + Intergenic
1023423390 7:40008202-40008224 AAATAGCTACATGTGGCTAGTGG - Intronic
1023465416 7:40449053-40449075 CAATAGCCACATGTGGCTAGTGG - Intronic
1024535219 7:50424988-50425010 AAATAGCCATACGTGGATAGCGG + Intergenic
1024986915 7:55202144-55202166 AAGTAGCCACATGTGGCTAGTGG - Intronic
1025016774 7:55445775-55445797 AAATACCCATATGTGGCTAGTGG - Intronic
1025048221 7:55711213-55711235 AAATAGCCACATGTAGCTAGTGG + Intergenic
1026334455 7:69381721-69381743 TAATATCCACATATTGAGGGAGG + Intergenic
1026462099 7:70623439-70623461 AAATAGCCACAGGTGGCTAGTGG - Intronic
1026869796 7:73843316-73843338 AAATAGCCACATGTGGCTAGTGG + Intergenic
1026920844 7:74154146-74154168 AAGTAGCCACATGTGGCTAGAGG - Intergenic
1027357121 7:77368405-77368427 AAATAGCCACATGTGGCTATTGG + Intronic
1027542553 7:79486135-79486157 CAATAGCCACACATGGCTAGTGG + Intergenic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1027898085 7:84071198-84071220 CAATAGTCACATATGGCTAGTGG + Intronic
1027943050 7:84709145-84709167 AAATAGCCATATATGAATAGTGG - Intergenic
1028851827 7:95546374-95546396 AAATATCTACACATTGAAAGAGG - Intergenic
1028971379 7:96862534-96862556 AAATAGCCACAGGTGGCTAGCGG + Intergenic
1029043249 7:97599604-97599626 CAATAGCCACATATGGCTAGTGG - Intergenic
1029093716 7:98068623-98068645 AAATAGCCACATGTGGCTAGTGG - Intergenic
1029310780 7:99661852-99661874 AAATAGCCACATGTGGATAGTGG - Intronic
1029315815 7:99712404-99712426 AAATAGCCACATGTCAATAGTGG - Intronic
1029431861 7:100536442-100536464 AAATAGCCACATATGATTAGTGG + Intergenic
1029937385 7:104441468-104441490 AAATATCCATTAATGGATAATGG - Intronic
1030168474 7:106578044-106578066 CAATACCTACATATGGTTAGTGG + Intergenic
1030361454 7:108599527-108599549 AAATATAGACATATGTTTAGCGG - Intergenic
1030689570 7:112518570-112518592 AAATAGCCACATATAGTCAGGGG + Intergenic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1030849338 7:114463382-114463404 CAGTAGCCACATGTGGATAGTGG - Intronic
1030858482 7:114591887-114591909 CAATAGCCACATATGGCTAGTGG - Intronic
1030952224 7:115805225-115805247 AAATACCCACATATGAACTGAGG - Intergenic
1031003145 7:116441009-116441031 CAATAGCCACATGTGGCTAGTGG + Intronic
1031273321 7:119683808-119683830 AAATAAACATGTATGGATAGTGG - Intergenic
1031675521 7:124607032-124607054 ATATAGCCACATGTGGCTAGTGG - Intergenic
1031768833 7:125816350-125816372 AAAAAGCCACATGTGGCTAGTGG - Intergenic
1031916831 7:127571258-127571280 AAATATACACATGTGCACAGAGG + Intergenic
1031963389 7:128009615-128009637 AAATAGCCACATGGGGCTAGTGG + Intronic
1032237368 7:130137106-130137128 AAATAACCACACATGGCTAGTGG + Intergenic
1032261856 7:130344619-130344641 AAATAGCCACATGTGGCTAATGG - Intergenic
1032334730 7:131014848-131014870 AAATAGCCACATGTGCCTAGCGG + Intergenic
1032434899 7:131892383-131892405 AAAGATCCACACATGGATATAGG + Intergenic
1032445373 7:131977966-131977988 CAATAGCCACATGTGGGTAGTGG + Intergenic
1032632803 7:133672063-133672085 CAATATCCACACATGACTAGTGG - Intronic
1032657124 7:133943011-133943033 AAATAGCCACACAAGGCTAGTGG - Intronic
1033160672 7:138993528-138993550 AAATATCCACATGTGGGTAGTGG + Intergenic
1033525501 7:142209812-142209834 CAATAGCCACATGTGGCTAGTGG - Intronic
1033827727 7:145212441-145212463 AAATAGCCACATCTGCCTAGTGG + Intergenic
1033971688 7:147048630-147048652 TAGTAGCCACATATGGTTAGTGG - Intronic
1034000815 7:147410643-147410665 AAATAGCCACATATGGCTAGTGG - Intronic
1034163555 7:149009440-149009462 AAAACTCCACATAGGGATATAGG - Intronic
1034300159 7:150008486-150008508 AAATATCCACAGGTGGTTAGAGG + Intergenic
1034805891 7:154088824-154088846 AAATATCCACAGGTGGTTAGAGG - Intronic
1035211031 7:157328290-157328312 AAATATCCAAAAATGGTTTGGGG - Intergenic
1036218333 8:6899603-6899625 AAATATCTAGAGATGGATAGTGG - Intergenic
1036836835 8:12077985-12078007 AGATATCAACATATGCATAATGG + Intergenic
1036858627 8:12324231-12324253 AGATATCAACATATGCATAATGG + Intergenic
1036944121 8:13078651-13078673 AAATAGCCTCATGTGGCTAGTGG - Intergenic
1037273061 8:17151180-17151202 CAATAGCCACATGTGGCTAGTGG - Intergenic
1038008266 8:23452471-23452493 AAATAACCACACATGGCAAGTGG - Intronic
1038196566 8:25373466-25373488 AAATATCCCCATAAGAAAAGGGG - Intronic
1038355165 8:26822464-26822486 AAATAGCCATACATGGCTAGTGG + Intronic
1038427768 8:27475602-27475624 AAAAATCTACAGATGGACAGTGG + Intronic
1038994899 8:32910965-32910987 CAATAGCCACATGTGGCTAGTGG - Intergenic
1039133704 8:34296741-34296763 AAATAGCCACATGTGGCTAATGG - Intergenic
1039373053 8:37005987-37006009 AAATAACCACGTATGGCTAGTGG + Intergenic
1039715816 8:40107554-40107576 AAATATTGATATATTGATAGTGG - Intergenic
1039757758 8:40541453-40541475 AAATAGCCACACATGGCTACTGG - Intronic
1039849300 8:41348493-41348515 AAATAGCCTTATATTGATAGAGG - Intergenic
1040124596 8:43722884-43722906 AAATATCCTCAGATGAAAAGTGG + Intergenic
1040395713 8:46998299-46998321 ATATATACATATATGGATATAGG - Intergenic
1040462887 8:47666250-47666272 CAGTAGCCACATATGGCTAGTGG + Intronic
1040599124 8:48866831-48866853 AAACAGCCACATGTGGCTAGTGG - Intergenic
1041171449 8:55146595-55146617 AAATAGTCACATGTGGCTAGTGG + Intronic
1042005605 8:64177112-64177134 AAATAACCACATTTTGATAAGGG + Intergenic
1042011520 8:64250894-64250916 AAATATTTACATATTGAGAGTGG + Intergenic
1042144839 8:65716922-65716944 CAATATCCACATGTGGCTAGTGG - Intronic
1042184066 8:66119797-66119819 AAATGTCCACATGTGGATAGTGG - Intergenic
1042688091 8:71463173-71463195 CAATAGCCACATGTGGCTAGTGG + Intronic
1042786497 8:72552467-72552489 AAATAGCCACATGTGACTAGTGG + Intronic
1043090103 8:75890804-75890826 TAAATTCCACTTATGGATAGAGG + Intergenic
1043264298 8:78243829-78243851 GAATAGCCACATATGCTTAGTGG - Intergenic
1043337313 8:79192476-79192498 AAAGATTCACATGTGGCTAGGGG - Intergenic
1043384862 8:79738201-79738223 GAATAGCCACATGTGGCTAGTGG - Intergenic
1044041085 8:87369078-87369100 AAATAACTACATAAGGATAATGG - Intronic
1044208900 8:89526105-89526127 AAATAGCCACATGTGGTTAGTGG + Intergenic
1044253871 8:90037166-90037188 CAATATCTACATGTGGATACTGG - Intronic
1044289798 8:90454248-90454270 AAATAGCTACATGTGGCTAGTGG - Intergenic
1044423684 8:92027176-92027198 AAATAGTCACATGTGGCTAGTGG - Intronic
1044526458 8:93257369-93257391 AAATAGTCACATGTGGTTAGTGG + Intergenic
1044570101 8:93708494-93708516 AAATAGCCCCATATGGCTAGTGG + Intronic
1044768920 8:95608647-95608669 TAATAGCCACATGTGGTTAGTGG + Intergenic
1044966930 8:97582824-97582846 AAATAGCCACATGTGGTTAATGG - Intergenic
1045127646 8:99110618-99110640 AAATAGCCACATATGGCTGGTGG + Intronic
1045601105 8:103717957-103717979 AAATAACCACATGTGGCTAATGG + Intronic
1045620577 8:103972876-103972898 AAATAACCACATACAGCTAGTGG - Intronic
1045818386 8:106304743-106304765 CAGTAGCCACATATGGCTAGTGG + Intronic
1046341072 8:112854942-112854964 CAATAGCCACATATTGCTAGTGG - Intronic
1046352304 8:113031830-113031852 TAATATCCACATGTTGAAAGAGG + Intronic
1046359828 8:113136268-113136290 CAATAGGCACATATGGCTAGTGG - Intronic
1046500883 8:115075016-115075038 CAATAACCACATGTGGTTAGTGG + Intergenic
1046558087 8:115801667-115801689 TAGTATCCACATGTGGCTAGGGG + Intronic
1046758311 8:117994087-117994109 AAATAGCCATATGTGGCTAGTGG - Intronic
1046933148 8:119861186-119861208 AAACATCCACCTGTGGCTAGTGG + Intergenic
1046990793 8:120450868-120450890 AAAGATCCACATATGTATGTTGG + Intronic
1047000708 8:120569843-120569865 AAGTAGCCACATCTGGCTAGTGG + Intronic
1047333459 8:123914059-123914081 AAATAGCCACACATAGCTAGTGG - Intronic
1047452529 8:124978389-124978411 AAATAGCTACATACGGCTAGAGG - Exonic
1047551900 8:125883184-125883206 AAATTTCAACATATGGATTTTGG - Intergenic
1047814345 8:128446331-128446353 AAATAGCTGCATATGGCTAGTGG + Intergenic
1047868524 8:129056491-129056513 AAATATCCACATTTGGCTTTTGG - Intergenic
1048039475 8:130711532-130711554 AAACATCCACGTATAGATAAAGG - Intergenic
1048892464 8:138959981-138960003 CAATAGCCACATGTGGCTAGTGG - Intergenic
1048892472 8:138960066-138960088 AAATATCCACAGGTGGCTACCGG + Intergenic
1049905530 9:213658-213680 CAATAGCCACATGTGGCTAGTGG + Exonic
1049974421 9:847811-847833 AAAAAGCCACATGTGGCTAGGGG - Intronic
1050297326 9:4218728-4218750 AAATAGCCACATGTGGCTAATGG + Intronic
1050348321 9:4715695-4715717 AAATATCAAAATATGGGAAGGGG - Intronic
1051004132 9:12321379-12321401 AAATAGCCATATATGGATAATGG - Intergenic
1051062688 9:13063034-13063056 AAATAGCCACATGTGGCTAGTGG + Intergenic
1051384162 9:16489332-16489354 AAATAGACACATGTGGCTAGTGG + Intronic
1051396031 9:16621705-16621727 CAATACCCACATGTGGCTAGTGG - Intronic
1051789769 9:20788068-20788090 AAATATCCATCCATTGATAGTGG + Intronic
1051791592 9:20809475-20809497 AAATAGCCAAATGTGGCTAGTGG + Intronic
1052193817 9:25688035-25688057 AAATAGACACACATGGTTAGTGG - Intergenic
1052211923 9:25914372-25914394 AAAAGTCTAGATATGGATAGTGG + Intergenic
1052369003 9:27643611-27643633 ATATATACACATATGTATATGGG - Intergenic
1052755352 9:32535409-32535431 AAATAGCCACATGAGGCTAGTGG - Intergenic
1052789084 9:32857431-32857453 ACATATCTAAATTTGGATAGGGG + Intergenic
1053031796 9:34786642-34786664 ACATTTCCACATATAAATAGAGG + Intergenic
1055092846 9:72380326-72380348 AAATAACTAGCTATGGATAGGGG - Intergenic
1055139135 9:72855607-72855629 CAATAGTCACATATGGCTAGTGG - Intergenic
1055219098 9:73906748-73906770 AAATAGTCACATGTGGCTAGTGG + Intergenic
1055234085 9:74098807-74098829 AAATAGCCACATGTGGCTAGTGG + Intergenic
1055507314 9:76961641-76961663 AAATAGTCACATGTGGTTAGTGG + Intergenic
1055806396 9:80098737-80098759 AAAGATTCACATATGTACAGAGG - Intergenic
1055990893 9:82104447-82104469 AAATATAAACATATGGCTAGTGG - Intergenic
1056055095 9:82813615-82813637 AAATAACCACATGTGGCTAGTGG - Intergenic
1056081071 9:83094210-83094232 CAAGATCCACATATGGCTAATGG - Intergenic
1056125707 9:83534946-83534968 AAATTTCCAGACATGGAAAGAGG - Intronic
1056279514 9:85027687-85027709 AAATAGCCACATATGGCTAGTGG + Intergenic
1056664202 9:88568262-88568284 AAATGCCCACATGTGGCTAGTGG + Intronic
1056998403 9:91485078-91485100 AAATAGCCACAGATGGCTGGTGG - Intergenic
1057583702 9:96310569-96310591 AAATAACCACATATGGCCAGTGG - Intergenic
1057747997 9:97767022-97767044 AAATAGCCACATGTGGCTGGTGG - Intergenic
1058175140 9:101726892-101726914 AAGTATCCATATTTGGGTAGAGG + Intronic
1058306528 9:103449148-103449170 AAATTGCCACATATGATTAGTGG - Intergenic
1058358915 9:104118730-104118752 AAAAAGTCACATATGGCTAGTGG - Intronic
1058888032 9:109337687-109337709 AAATAGCCACAGGTGGCTAGTGG - Intergenic
1058980760 9:110167983-110168005 CAATAGCCACGTATGGCTAGTGG + Intronic
1059245898 9:112849306-112849328 AAATAGCCACATATGGCTAGTGG - Intronic
1059767146 9:117394400-117394422 CAATAGCCACATATGGCTAGTGG + Intronic
1060075710 9:120588993-120589015 AAATAGCCACATGGGGCTAGTGG + Intergenic
1060084722 9:120686765-120686787 TAATATCCACATTTGTACAGGGG - Intronic
1060432783 9:123564756-123564778 AAATAGCCATATGTGAATAGTGG + Intronic
1060687725 9:125626486-125626508 AAATAGCCAAATGTGGCTAGTGG - Intronic
1061300557 9:129702474-129702496 CAATATCCACACATGGCCAGTGG - Intronic
1061526850 9:131172696-131172718 AAATAACCACATATGGCTACTGG + Intronic
1062480890 9:136750840-136750862 AAATATAGACATATAGAAAGGGG + Intergenic
1203522927 Un_GL000213v1:60561-60583 CAATAGCCACATGTGGCTAGTGG - Intergenic
1186281381 X:7996768-7996790 AAATATCCATATTTGAATAAAGG - Intergenic
1186363500 X:8867792-8867814 AAATCTCAACATATGGTTTGGGG + Intergenic
1186623970 X:11272212-11272234 AAATTACCACAGGTGGATAGTGG + Intronic
1186626715 X:11302182-11302204 AAATAGCCACATGGGGCTAGTGG + Intronic
1186830516 X:13385344-13385366 AAATAGCCACATGTGTTTAGTGG - Intergenic
1186846536 X:13536323-13536345 CAGTAGCCACATATGGCTAGTGG + Intergenic
1186866184 X:13723156-13723178 AAATAGCCATATGTGGCTAGTGG + Intronic
1187007132 X:15243509-15243531 AAATATGCACAAATGGCTAGTGG - Intronic
1187057503 X:15754881-15754903 AAATACCCACATGGGGTTAGTGG - Intronic
1187094197 X:16129311-16129333 AAATAGCCACATGTGGTTAGTGG - Intronic
1187142938 X:16611562-16611584 AAGTAGCTACATATGGCTAGTGG - Intronic
1187174471 X:16883587-16883609 ACATATCCACTTGTGGCTAGTGG - Intergenic
1187174514 X:16883971-16883993 AAATAGCCACACATGGCTACTGG + Intergenic
1187254087 X:17626119-17626141 CTATAACCACATATGGCTAGGGG + Intronic
1187312927 X:18163352-18163374 AAATAGCCACAAGTGGATAGTGG - Exonic
1187334429 X:18369802-18369824 AAATAGACACATGTGGCTAGTGG - Intergenic
1187556365 X:20356156-20356178 TAATAGCCACATGTGGCTAGTGG - Intergenic
1187810900 X:23175485-23175507 AAATATACTCATATCCATAGGGG + Intergenic
1187815405 X:23226227-23226249 AAATAGCCACATGTGCCTAGTGG + Intergenic
1187941826 X:24390073-24390095 AAATAGCCACATGTGGTTAGTGG + Intergenic
1187959225 X:24552556-24552578 AAATAGCCACGTGTGGCTAGTGG + Intergenic
1187983390 X:24783795-24783817 AAATAGCCACCTGTGGCTAGTGG - Intronic
1188152213 X:26691570-26691592 AAATATCCACAGGTAGTTAGTGG + Intergenic
1188914945 X:35898882-35898904 AAATAGCCACATGTGGCTAGTGG + Intergenic
1189350771 X:40273968-40273990 AAGTAGCCACATGTGGCTAGTGG + Intergenic
1189368809 X:40411655-40411677 CAATACCCACATGTGGCTAGTGG - Intergenic
1189498541 X:41531678-41531700 CAATAACCACGTATGGTTAGTGG + Intronic
1189532929 X:41905580-41905602 AAATAGCCACATCTGGCTAGTGG + Intronic
1189579032 X:42386301-42386323 AAATAGCCACATGTGGCTAGCGG + Intergenic
1190096802 X:47487879-47487901 CAGTACCCACATATGGCTAGTGG + Intergenic
1190113822 X:47612707-47612729 ATATATCCACTTATGGGCAGTGG + Intronic
1190764730 X:53466479-53466501 AAATAGCCACATGTAGCTAGTGG - Intergenic
1192345397 X:70299492-70299514 AAATAGCCACTTGTGGCTAGTGG - Intronic
1192902003 X:75509425-75509447 TAATAGCCACATGTGGCTAGTGG + Intronic
1193737691 X:85179164-85179186 AAATAGCCACATGTGGCTAGTGG + Intergenic
1193866093 X:86731952-86731974 AAATACCCACACATGCCTAGTGG - Intronic
1194190906 X:90836216-90836238 AAATATTCACATTTGGGGAGTGG + Intergenic
1194267659 X:91775393-91775415 CAGTAGCCACATGTGGATAGTGG + Intergenic
1194272710 X:91837912-91837934 TAATAGCCACATGTGGTTAGTGG + Intronic
1194397980 X:93410105-93410127 CAATAGCTACATATGGATACAGG - Intergenic
1194807957 X:98353148-98353170 CAATAGCCACATGTGGCTAGTGG - Intergenic
1195044116 X:101040679-101040701 AAATTGCCACATATGGCTACTGG + Intronic
1195454087 X:105048859-105048881 CAATAACCACATGTGGCTAGTGG + Intronic
1195652383 X:107298658-107298680 CAATAGCCACATGTGGCTAGTGG + Intergenic
1195762424 X:108261239-108261261 CAATAGCTACATATGGCTAGAGG + Intronic
1195927053 X:110036932-110036954 AAATAGCCACATGTAGCTAGTGG + Intronic
1195952413 X:110289204-110289226 AAATTGCCACATGTGGATAATGG - Intronic
1196011543 X:110893156-110893178 AAATAGCCACACATGGCTAGTGG - Intergenic
1196112306 X:111959996-111960018 AAATAGCCACTTGTGGCTAGTGG - Intronic
1196387839 X:115177612-115177634 AAATAGACACATGTGGCTAGTGG - Intronic
1196684797 X:118501543-118501565 CAATAGCCACATGTGGCTAGTGG + Intronic
1196754360 X:119144974-119144996 AAACAACCACATGTGGCTAGTGG - Intronic
1197085521 X:122469422-122469444 AAATATCCATATGTGGCTAGTGG + Intergenic
1197669636 X:129262327-129262349 CAATAGCCACATATAGCTAGTGG + Intergenic
1197791777 X:130262232-130262254 AAGTAGCCACATGTGGCTAGTGG - Intronic
1197845036 X:130792456-130792478 AAAGAGCTACATATGGCTAGTGG - Intronic
1197852769 X:130881174-130881196 CAATAGCCACATGTGGCTAGTGG + Intronic
1198665567 X:139018539-139018561 CAAAATCCACAAAGGGATAGAGG + Intronic
1198703707 X:139424138-139424160 CAATAGCCACATGTGGCTAGTGG + Intergenic
1198715362 X:139552540-139552562 AAATAGCCATATGTGGCTAGTGG - Intronic
1199309374 X:146305246-146305268 AAATAGCTACATATGGCTAGTGG - Intergenic
1199584340 X:149397874-149397896 AAATATCAACATATGACTAGTGG + Intergenic
1199975368 X:152892070-152892092 AAATAGCCACATGTGGCCAGTGG + Intergenic
1200537567 Y:4418633-4418655 AAATATTCACATTTGGGGAGTGG + Intergenic
1200810917 Y:7483884-7483906 AATTAGCCACAGATGGCTAGAGG - Intergenic
1200836384 Y:7736125-7736147 AAATAGCCACATGTGGCTAGTGG - Intergenic