ID: 957379652

View in Genome Browser
Species Human (GRCh38)
Location 3:79410216-79410238
Sequence TGGTATGTATTTTCACGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957379650_957379652 -8 Left 957379650 3:79410201-79410223 CCATCCTTGCAATAATGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG 0: 1
1: 0
2: 1
3: 10
4: 128
957379648_957379652 20 Left 957379648 3:79410173-79410195 CCTCATCTTTAAATGGAAGTGGT 0: 1
1: 1
2: 5
3: 37
4: 381
Right 957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957379652 Original CRISPR TGGTATGTATTTTCACGTAA TGG Intronic
905627210 1:39497139-39497161 TGGTATGTATATTCATGCAATGG - Intronic
906339886 1:44970153-44970175 AGTTATGTTTTTTCACTTAAAGG - Intronic
908031470 1:60004545-60004567 TAGTATGTATTTTTTCCTAATGG - Intronic
909633264 1:77788641-77788663 TTGTATGTATTATTAGGTAAGGG + Intronic
912177778 1:107181920-107181942 TGGCATTTTTTTTCACCTAAAGG - Intronic
914905430 1:151739829-151739851 TTGAATGAATTTTCACTTAAGGG - Intergenic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
918980234 1:191547982-191548004 GGGAATGTATTTTCAAATAAAGG - Intergenic
919061841 1:192643442-192643464 TGATATGTATTGTTATGTAAAGG + Intronic
919429356 1:197473661-197473683 GGGTATGTCTTTTCAGGAAAAGG + Intronic
920236330 1:204508730-204508752 TGTTTTGTATTTTCAAGAAAAGG + Intergenic
922015878 1:221646409-221646431 TGGTATGTCATTTTACTTAATGG - Intergenic
1065548834 10:26849898-26849920 TGCAATGTATTTTAAAGTAATGG + Intronic
1067650398 10:48149139-48149161 TGCTATGTATATTTTCGTAAAGG + Intergenic
1069216662 10:65829923-65829945 TAGTATGTATTTTCAAATTAGGG + Intergenic
1072085170 10:92072162-92072184 GGGTATGTTTTTTCATTTAAAGG - Intronic
1072861685 10:99012717-99012739 TGATTTGTATTTTGACTTAACGG + Intronic
1074416378 10:113270613-113270635 ATGTATGTATTTGAACGTAATGG - Intergenic
1076772026 10:132671019-132671041 TTGGATGTCTTTTCCCGTAAGGG + Intronic
1079292764 11:19203072-19203094 TGGTCTGTGTTTTCACTAAATGG + Intronic
1079378465 11:19915491-19915513 TAGTATGTGTTTTCATGCAAAGG + Intronic
1079892788 11:26079031-26079053 TGTTATCTATTTCCAAGTAAGGG + Intergenic
1082581549 11:54875934-54875956 TGATGTGTATTTTCACCTCATGG - Intergenic
1084567109 11:69936831-69936853 TGTTATGCATATTCATGTAAAGG - Intergenic
1085838415 11:79981563-79981585 TGGGAAGCATTTTTACGTAAAGG + Intergenic
1089657263 11:119958943-119958965 TGTTTTGTGTTTTCATGTAAAGG - Intergenic
1091936381 12:4437795-4437817 TGGAATTTATTTTGATGTAAGGG - Intronic
1094739222 12:33269571-33269593 TGGTATGTATTTTTAAGAAAAGG - Intergenic
1095063863 12:37740205-37740227 TGATATGTGTTTTCTCCTAACGG + Intergenic
1096949032 12:55445266-55445288 AAGTATGTATTTTCCTGTAATGG + Intergenic
1097386553 12:58956725-58956747 TGATTTATATTTTCACTTAAGGG - Intergenic
1098909243 12:76192307-76192329 TGGTATATATTTTAAGGGAAGGG + Intergenic
1100819020 12:98413834-98413856 TGGTATGTGTTTTCTCATTACGG + Intergenic
1106350642 13:28926817-28926839 TAGTATGTAATTTCATGCAAGGG + Intronic
1108005781 13:45944852-45944874 TGGAATGTTTTTTAACATAATGG + Intergenic
1108918391 13:55644569-55644591 TTGTTTGTTTTTTTACGTAATGG - Intergenic
1109762714 13:66850675-66850697 TGGAATATATTTTCACATCAAGG - Intronic
1110173211 13:72526884-72526906 TGTTATCTATTTTCAGGCAATGG + Intergenic
1110221155 13:73075559-73075581 TGATATGTATTTACTCATAATGG + Intronic
1110748519 13:79084989-79085011 TGTTAATTATTTTCACATAATGG - Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1111534412 13:89583608-89583630 TTGTATGTATTTTAAAGAAATGG + Intergenic
1115925807 14:38432547-38432569 TGGTGTGTATTTTTAAATAATGG - Intergenic
1122370419 14:101226275-101226297 GGGCATGGATTTTCACGTAAAGG + Intergenic
1122431177 14:101646607-101646629 TTGTATGTGGTTTCAGGTAAGGG - Intergenic
1123814806 15:23966141-23966163 TTGTATGTATATTCATGTACAGG - Intergenic
1144761878 17:17711638-17711660 TAGGATGAAGTTTCACGTAAAGG + Intronic
1203205733 17_KI270730v1_random:34591-34613 TGGAATGAATTTTAACGGAATGG + Intergenic
1203212313 17_KI270730v1_random:90514-90536 TGGTATGGATTTTTATGGAATGG + Intergenic
1164871250 19:31645825-31645847 TGCGCTGTATTTTCACGTGATGG + Intergenic
1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG + Intergenic
929250909 2:39754023-39754045 TTTTATGTATTTTCACTTTAGGG - Intronic
929483533 2:42335381-42335403 TGTTATTTATTTTCAAGTTAAGG - Intronic
930410742 2:51023588-51023610 TGGTATGTATTTTGAAGGATGGG - Intronic
930788372 2:55296398-55296420 TGGTCTGTCTTTTCAAGTACTGG + Exonic
935981362 2:108631197-108631219 AGGTATATATTATCAAGTAAAGG - Intronic
939431801 2:142119187-142119209 TGGTATGTTTTTACACTTAAGGG - Intronic
944354200 2:198766372-198766394 TGCTACATATTTTCACGTAAAGG + Intergenic
944741858 2:202620266-202620288 TGGTTTGTTTTTTCCCTTAAAGG - Intergenic
945543897 2:211124666-211124688 TGGTATCTATTGTCACTTATTGG - Intergenic
948539064 2:238673501-238673523 TGGTATGTATTTTCATGAAGAGG + Intergenic
1171923090 20:31166769-31166791 TGGAATGGATTTTAATGTAATGG + Intergenic
1174673155 20:52327050-52327072 ATGTATGTATTTTAAAGTAATGG + Intergenic
1175794540 20:61763432-61763454 TGGGAGGCATTTTCACGCAATGG + Intronic
1176658726 21:9613950-9613972 TGGTACGTATTCTCAAGGAAGGG + Intergenic
1181117045 22:20638347-20638369 TGGGAGGTATTTTCCAGTAAAGG + Intergenic
1181711145 22:24690815-24690837 TGATTTGTATTTTGACTTAATGG - Intergenic
1184395703 22:44237158-44237180 TGGTATGTTTTTTAAAGTTAGGG + Intergenic
1203305425 22_KI270736v1_random:105753-105775 TGGAATGGATTTTAACGGAATGG + Intergenic
949714485 3:6913482-6913504 TGGTAAGTATTTTCACATAACGG - Intronic
951059523 3:18188799-18188821 TAATATATATTTTCACGAAATGG - Intronic
957182046 3:76891707-76891729 TGGTCTGGATCTTCACGAAAAGG + Intronic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
959333483 3:105035668-105035690 TGGTAAGTATTTTCAAGTCCTGG + Intergenic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
962664856 3:137643582-137643604 TGGTAAGGATTTTAAAGTAATGG + Intergenic
962826884 3:139106868-139106890 AGAGATGTATTTTCAAGTAATGG - Intronic
964119514 3:153168088-153168110 TGGTATGCATTTTCCCAGAATGG - Intergenic
964584626 3:158283535-158283557 AGTTATGTATTTTCACGAAATGG - Intronic
965471792 3:169102569-169102591 TGGTATGGATATTAACATAACGG + Intronic
966417346 3:179702814-179702836 TGGTATATAATTTCAGGTAATGG - Intronic
966569288 3:181423103-181423125 TGGGAAGTATTTTCAACTAAAGG + Intergenic
968435256 4:582730-582752 TGGTAATTATTTTCAAGAAATGG - Intergenic
970522915 4:16903532-16903554 GGGTAAGTATTTCCACTTAAAGG - Intergenic
971823839 4:31595639-31595661 TGGTATGAATGTTCACATAGTGG + Intergenic
973403845 4:49655231-49655253 TGGTATGTAATGTAATGTAATGG + Intergenic
974072104 4:57133317-57133339 TTGTTTTTATTTTCACATAAGGG - Intergenic
974514759 4:62895687-62895709 TGGTAAATATTTTGACTTAAAGG + Intergenic
976177356 4:82368184-82368206 TGGTATGTATTATGACTTGAAGG + Intronic
978896844 4:113898891-113898913 TGCTATGTATTTTCAAGTGCAGG - Intergenic
979846066 4:125513724-125513746 TGGGATTTATTTTCTAGTAATGG + Intergenic
980656097 4:135788584-135788606 AGATATGTATCTTCAAGTAAAGG + Intergenic
982857369 4:160401094-160401116 TCAAATGTATTTTCACATAATGG - Intergenic
983868130 4:172792160-172792182 TGTTTTCTATTTTCACGTCATGG - Intronic
987378462 5:17260114-17260136 TGTTATTTATTTGCACTTAACGG - Intronic
990699865 5:58462662-58462684 TGGTATGTATCTTTACCAAATGG + Intergenic
994634575 5:102328506-102328528 TGGTTTGTATTGGCAAGTAAGGG - Intergenic
998806467 5:145921891-145921913 TGCTATTTATTTTCACTTAAAGG + Intergenic
1000912756 5:167042133-167042155 TGATTTGTATCTTCATGTAATGG - Intergenic
1007893982 6:45328645-45328667 TGGTTTGTATTTTCAGTTTAAGG + Exonic
1008466445 6:51836457-51836479 TGGTATTTAGTTTCAGGTGAAGG - Exonic
1008748007 6:54696847-54696869 TGCTAAGTTTTTTCACATAAGGG + Intergenic
1009652270 6:66491058-66491080 TGGTATGTTTTTGCACTGAATGG - Intergenic
1016397105 6:143636309-143636331 TGAAATGTATTTTTACATAAGGG + Intronic
1017022904 6:150155048-150155070 TGGTATTTATTTTAACTTGAGGG + Intronic
1017795333 6:157839401-157839423 GCATATGTATTTTCATGTAATGG + Intronic
1018692247 6:166356295-166356317 TGCTATGTATTTTCTCATTATGG - Intergenic
1024868867 7:53938056-53938078 TCCTATGCATTTTCACGTATAGG - Intergenic
1028788360 7:94823106-94823128 AGGTATGTATTTTCATTTCAAGG - Intergenic
1030876107 7:114815513-114815535 TAGTATCTATTTTCAAGGAACGG + Intergenic
1032683156 7:134206213-134206235 TGATATGTATTTTAAATTAAGGG - Intronic
1038815575 8:30899966-30899988 TGCTATGCATTTTCAAGAAAAGG + Intergenic
1041117428 8:54553658-54553680 TGGTACATATTTTCAAGTCATGG - Intergenic
1041420820 8:57665785-57665807 GAGTATGAATTTTTACGTAAAGG + Intergenic
1043268838 8:78302927-78302949 TGGTACGTATTTTCAGGTGTTGG - Intergenic
1046012386 8:108565342-108565364 TGGTCTGTATTGTCACCTGAAGG + Intergenic
1048086026 8:131180532-131180554 TGGTATGTATTTTGTCTGAAGGG - Intergenic
1048420971 8:134278013-134278035 TGGGATGTATTTTGCAGTAAAGG + Intergenic
1052162232 9:25278367-25278389 TTGTATTTATCTTCACGTATGGG - Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055596647 9:77872263-77872285 TGTTAGGAATTTTCACATAATGG - Intronic
1056370100 9:85945352-85945374 TGGTATTTATTTTCCCGTCTTGG + Intronic
1058377514 9:104340455-104340477 TGGTATATATATTCATGAAATGG + Intergenic
1058631520 9:106993126-106993148 TAGAATGTATTTTCAGTTAAAGG + Intronic
1059578700 9:115520092-115520114 TTGTGTGTATTTTCAGATAACGG + Intergenic
1203726306 Un_GL000216v2:52375-52397 TGGAATGTATTGTAATGTAATGG - Intergenic
1203636453 Un_KI270750v1:117529-117551 TGGTACGTATTCTCAAGGAAGGG + Intergenic
1189533705 X:41913909-41913931 TGGTATGTGATTTCCCCTAAAGG - Intronic
1189740082 X:44108556-44108578 TGGTATGCATATTCATGTACAGG + Intergenic
1190894348 X:54601943-54601965 TGGTATGTATATCCATATAATGG - Intergenic
1190924016 X:54885234-54885256 TGGTATGTATATCCATATAATGG + Intergenic
1192952393 X:76030689-76030711 TGATTTGTATTTTGACTTAATGG - Intergenic
1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG + Intergenic
1196347000 X:114674613-114674635 TGCTATGCATTTTGACTTAAGGG - Intronic
1196470361 X:116017311-116017333 TGGTATGTATATACAAGTGAGGG + Intergenic
1197020680 X:121684192-121684214 TGGAATTTATATTCAAGTAAGGG + Intergenic
1197190853 X:123646629-123646651 GTGTATGTATTTTCCCATAAAGG - Intronic
1201112554 Y:10810950-10810972 TGGAATGGATTTTAACGGAATGG - Intergenic
1201113427 Y:10817769-10817791 TGGAATGTATTGTAACGGAATGG - Intergenic
1201124088 Y:10898227-10898249 TGGAATGTATTGTAACGGAAAGG - Intergenic