ID: 957382451

View in Genome Browser
Species Human (GRCh38)
Location 3:79449830-79449852
Sequence TGTGATGGCCATAGTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957382449_957382451 15 Left 957382449 3:79449792-79449814 CCAATAGATTTAAGCTCTTCATT 0: 1
1: 0
2: 2
3: 20
4: 219
Right 957382451 3:79449830-79449852 TGTGATGGCCATAGTGTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957382451 Original CRISPR TGTGATGGCCATAGTGTGTC AGG Intronic
903298121 1:22358884-22358906 TGTGATGGCCCTGGTGGGGCAGG + Intergenic
904619967 1:31769417-31769439 TGTGATGGGGACAGTGTGTGGGG + Intergenic
909747264 1:79113127-79113149 TGTCAGGCCCATATTGTGTCTGG - Intergenic
910334537 1:86112046-86112068 TATGATAGTCATATTGTGTCCGG - Intronic
913240563 1:116826177-116826199 TGTGATGGCCAGGGTGTGTGGGG - Intergenic
913240578 1:116826241-116826263 TGTGAGGGCCAGGGTGTGTGGGG - Intergenic
913240603 1:116826323-116826345 TGTGAAGGCCAGGGTGTGTAGGG - Intergenic
917280844 1:173377164-173377186 TGTGGTTGCCAAAATGTGTCTGG - Intergenic
918433134 1:184483093-184483115 TGAAAGGGCCACAGTGTGTCAGG - Intronic
920826201 1:209426221-209426243 TGTGCTTGCCTGAGTGTGTCTGG - Intergenic
920959765 1:210653972-210653994 TGTGATGGGAATAGTGTGACGGG + Intronic
921664856 1:217856506-217856528 TGTGATGGCCAGAGTCTCACTGG - Intronic
923744565 1:236687703-236687725 TGTGGTGACCATAGTGTGTATGG + Intronic
1064507555 10:16049742-16049764 TGTGCTGCCCATAGTTTGTGAGG + Intergenic
1065264103 10:23957197-23957219 TGTGCTGGCCCTCGTGTGCCTGG + Intronic
1067215187 10:44295397-44295419 TGTGATGTGTGTAGTGTGTCTGG - Intergenic
1067217106 10:44312286-44312308 TGTGGTGGACTTAGTGTCTCTGG - Intergenic
1068406740 10:56599407-56599429 TGTGTGGTCCATAGTGTGACAGG - Intergenic
1069045685 10:63741023-63741045 TGTCATGGCAATAGTGAGTTCGG - Intergenic
1072680712 10:97504242-97504264 TGGGATGGAAATAGTCTGTCGGG - Intronic
1076703769 10:132290102-132290124 TCTGCTGGCCATAGGGTGGCCGG - Intronic
1077411118 11:2404382-2404404 TGTACTGGCCATCGGGTGTCAGG + Intergenic
1083499972 11:63096138-63096160 TGAGATGTCAATAATGTGTCAGG + Intronic
1084505961 11:69568172-69568194 TGTGATGGGCAAAGTCTGCCAGG - Intergenic
1089001159 11:115053595-115053617 TGTGATGGCCCTAGTGAGCTTGG - Intergenic
1089667055 11:120027146-120027168 TCTGCTGGTCAAAGTGTGTCCGG - Intergenic
1090007835 11:123018520-123018542 TGAGATGGCCCCAGTGTGTGCGG + Intergenic
1093343393 12:18007730-18007752 TGTGATGCCAATAGTGTGGGAGG + Intergenic
1095796460 12:46224588-46224610 TGTGTTGGCCAATGTGAGTCTGG + Intronic
1101704599 12:107210394-107210416 TGTGGTTGCCAAAATGTGTCTGG - Intergenic
1102496428 12:113322604-113322626 TGAGATGGACATAGTATGTTTGG + Intronic
1103919801 12:124393405-124393427 CATGATGGCCATAGGGTTTCTGG - Intronic
1103977197 12:124710792-124710814 TGTGATGGCCTTAGAGGGTGGGG - Intergenic
1108460743 13:50665188-50665210 TAAGATGGACATGGTGTGTCTGG + Intronic
1109729368 13:66390780-66390802 TGTGATAGCCATAGTCTCTAAGG - Intronic
1116390722 14:44385949-44385971 TTTCGTGGCCATGGTGTGTCCGG - Intergenic
1117056435 14:51916727-51916749 TGTGATGGACAGGGTATGTCAGG + Intronic
1118079594 14:62343048-62343070 TGTGATGACCTCAATGTGTCAGG - Intergenic
1119050495 14:71363442-71363464 TGAGATTGTCATAGTGTTTCTGG + Intronic
1122298038 14:100716521-100716543 TGTAATGGCCTTAGTGGGTGGGG - Intergenic
1123074482 14:105661212-105661234 TGTGATATCCATGGTGTGCCAGG - Intergenic
1129660336 15:77549622-77549644 TGGGGTGGCCTTGGTGTGTCAGG + Intergenic
1133834288 16:9352206-9352228 TGTGATGGACAATGTGTCTCTGG + Intergenic
1134082403 16:11334117-11334139 TGTCATGGCCATGGTGGGGCTGG - Intronic
1134315222 16:13112802-13112824 TGTGATGGCCAAAGAATGTGTGG + Intronic
1135224452 16:20643361-20643383 TGTGGTTGCCAAACTGTGTCTGG + Intronic
1136564417 16:31061502-31061524 TGTGATGGCCACACAGTGGCAGG - Exonic
1144482905 17:15642248-15642270 TGAGAAGGCCATGGTGTGCCAGG - Intronic
1144915779 17:18722783-18722805 TGAGAAGGCCATGGTGTGCCAGG + Intronic
1149097611 17:52862423-52862445 TGTGGTCGCCAAAATGTGTCCGG - Exonic
1150651630 17:67014081-67014103 GGTGAGGGCCACAGTGTCTCTGG + Intronic
1150851717 17:68709625-68709647 AGTGATGACCAGAGTGAGTCAGG + Intergenic
1154047351 18:10918685-10918707 TGTGCTGGTCTTAGTGTGTGGGG - Intronic
1155217007 18:23652147-23652169 TGTGCCGGCCATAGGGTGACAGG - Intronic
1157858215 18:51120115-51120137 TGTGGTCGCCAAAATGTGTCTGG + Intergenic
1161237255 19:3204251-3204273 TCTGAGGGCCACACTGTGTCGGG + Intronic
1161651063 19:5485336-5485358 TGGGATGGCCTCAGTGGGTCAGG - Intergenic
1161978953 19:7620723-7620745 AGGGATGGCCATGGTGTGTTGGG - Intronic
1167433939 19:49468428-49468450 TGTGCTGGCTGTGGTGTGTCCGG + Exonic
927393479 2:22622722-22622744 TGTGATGACCAGCCTGTGTCTGG - Intergenic
928084866 2:28339733-28339755 TGGGAAGGCCAGAGGGTGTCAGG - Intergenic
929579610 2:43073491-43073513 GCTGATGGCCAAATTGTGTCTGG + Intergenic
932318927 2:70806336-70806358 TGAGATGGCACTAGTGAGTCTGG + Intergenic
933950210 2:87322732-87322754 TGGGCAGGCCATAGTGGGTCAGG + Intergenic
935790203 2:106584039-106584061 TGTCATGGCCCAAGTGCGTCAGG + Intergenic
935946734 2:108293657-108293679 GGTCAGGGCCATAGTGTCTCAGG - Exonic
936329977 2:111538865-111538887 TGGGCAGGCCATAGTGGGTCAGG - Intergenic
939651214 2:144764741-144764763 TGTAATGGCAATAGTGGATCTGG + Intergenic
940143226 2:150518482-150518504 TGTGGTGGCCATAGTGACTTAGG + Intronic
946165257 2:217859605-217859627 TGGGAAGGCCAGTGTGTGTCTGG + Intronic
948779738 2:240311416-240311438 TGCGATGGCCCCAGTGTGTGAGG - Intergenic
948972947 2:241443442-241443464 AATGATGCCCATGGTGTGTCTGG - Intronic
1170442275 20:16391076-16391098 TGTGATGAGCATAGTGTGGGTGG + Intronic
1170777972 20:19395208-19395230 TGTAATGGTCATAGAGTTTCAGG + Intronic
1175793119 20:61754667-61754689 TGTGGTGTGCATAGTGTGTGCGG - Intronic
1175793125 20:61754732-61754754 TGTGGTGTGCATAGTGTGTGCGG - Intronic
1177267625 21:18804791-18804813 AGTGATGGTCATACTGTTTCTGG + Intergenic
1180165123 21:46021739-46021761 TGGGAAGTCCATTGTGTGTCTGG - Intergenic
1184388787 22:44191208-44191230 TGTGATGCTCAGAGTCTGTCTGG - Intronic
1184407140 22:44306667-44306689 TGTGATGACGATGGTGTGTGTGG + Intronic
1184750704 22:46484671-46484693 TCTGATGGCCACAGGGTCTCTGG - Intronic
950586146 3:13894030-13894052 TGTGCTTGCCACAGTGTGCCAGG - Intergenic
952452701 3:33447018-33447040 TGTGGTTGCCAAAATGTGTCTGG - Intergenic
953522270 3:43655176-43655198 GGTAATAGCCAAAGTGTGTCCGG + Intronic
955876637 3:63497078-63497100 TGTGATGGTCATATTGGGTAAGG - Intronic
956501084 3:69885831-69885853 TGTGATGCCTATATTCTGTCTGG + Intronic
957382451 3:79449830-79449852 TGTGATGGCCATAGTGTGTCAGG + Intronic
960798912 3:121517797-121517819 TATGATGGCTGTAGTGTGTCGGG - Intronic
968936462 4:3612931-3612953 TGTGGTGTGCATAGTGTGTGTGG - Intergenic
976011216 4:80491734-80491756 TGTTATGGCCAGAGTCAGTCTGG - Intronic
976926382 4:90502819-90502841 TGTTCTGGCTATAGTCTGTCTGG - Intronic
977719670 4:100224512-100224534 TGTGATGTCAATAGGGTTTCAGG + Intergenic
986601199 5:9474786-9474808 TGGTATGGCCAGAGTGTCTCGGG - Intronic
986863060 5:11950693-11950715 TGTGTGTCCCATAGTGTGTCAGG + Intergenic
987352116 5:17031583-17031605 TGGTATGATCATAGTGTGTCCGG + Intergenic
991542752 5:67748036-67748058 GCTGCTGGCTATAGTGTGTCAGG - Intergenic
992500723 5:77340357-77340379 CGTGATAGCCATTGTGTTTCAGG + Intronic
994142005 5:96352091-96352113 TGTGATGGCCAAAGACTGGCTGG + Intergenic
999212219 5:149899749-149899771 TGTCAGGGCCAGTGTGTGTCAGG + Intronic
1002623354 5:180506544-180506566 TGTAATGGCAAAAGTGTGTTGGG - Intronic
1002939173 6:1700822-1700844 TGGGATGGCCTTTGAGTGTCAGG - Intronic
1004427822 6:15517962-15517984 TGTGAGGGGCCTGGTGTGTCTGG + Intronic
1008270333 6:49482724-49482746 TGTGGTCGCCAAAATGTGTCTGG + Intronic
1015586790 6:134784553-134784575 TGGGGAGGCCAGAGTGTGTCAGG + Intergenic
1016482118 6:144494110-144494132 TGTGGTAGACTTAGTGTGTCTGG + Intronic
1017074594 6:150606142-150606164 TTTGATTGCCGAAGTGTGTCAGG + Intronic
1020980046 7:15055554-15055576 TGTGGTGGCCAGAGAGTATCAGG - Intergenic
1023792396 7:43763257-43763279 TGTGATGGCCACAGCAGGTCTGG - Intronic
1026372071 7:69710215-69710237 TGTGAGAGCTATAGTTTGTCAGG + Intronic
1027216727 7:76188564-76188586 TGGGATGGCCATCCTGTGCCAGG - Intergenic
1037711258 8:21357210-21357232 TGTGTTGGCATTAGTCTGTCTGG + Intergenic
1039693486 8:39884946-39884968 TGTGGTTGCCAAAATGTGTCTGG + Intergenic
1045551818 8:103179859-103179881 TGTGATGGCCTTAGAGTCTCAGG + Intronic
1047686207 8:127306997-127307019 TGAGTTGGCCATAGGGAGTCTGG + Intergenic
1049849999 8:144826046-144826068 TGTGAGGGCCTGAGTGTGCCTGG + Intergenic
1051221022 9:14848527-14848549 TGTGATGCCCTTAATCTGTCTGG + Intronic
1056698122 9:88878052-88878074 TGTGGAGGCCATAGAGTGTGAGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057440733 9:95081324-95081346 TCTGATGTCCGCAGTGTGTCAGG + Intronic
1057783983 9:98073106-98073128 TGGGATGGCCACTGTGTGTGAGG - Intronic
1058101066 9:100918033-100918055 TGTTCTGGCGACAGTGTGTCAGG + Intergenic
1060767607 9:126306783-126306805 TGTGAAGGCGATAGTGGGTCTGG + Intergenic
1185488679 X:502204-502226 TGTGTTGTGCATAGTGTGTGTGG - Intergenic
1186165891 X:6825530-6825552 GGTGATGGACATGGTGTTTCTGG + Intergenic
1186443360 X:9604808-9604830 TGTTCTGGCCATAGAGGGTCAGG + Intronic
1190488378 X:50954746-50954768 TGTTATGGCCACACAGTGTCTGG + Intergenic
1193925498 X:87479014-87479036 TCTGATAGCAATAGTGTGTGGGG - Intergenic
1194456695 X:94113463-94113485 TGTGTTGGGCATAGTGTGTTGGG - Intergenic
1199476438 X:148251501-148251523 TGAGGTGGCTATAGTGTGGCTGG - Intergenic
1199733109 X:150656545-150656567 TGTGATTGCGATAGTGTGCTAGG - Intronic
1200044107 X:153391796-153391818 TGTGGTGTGCATAGTGTGTGTGG - Intergenic
1201245064 Y:11995281-11995303 TGTGATGACCAAAATGTCTCTGG + Intergenic
1201299177 Y:12491107-12491129 TATGCTGGCCAGAGTCTGTCTGG - Intergenic
1201555415 Y:15261241-15261263 CGTGGTTGCCAAAGTGTGTCTGG - Intergenic
1202192124 Y:22256344-22256366 TCTAATGGCCCTAGTGTGTCTGG + Intergenic
1202242555 Y:22786557-22786579 TGTGATTGCCAAAATGCGTCTGG - Intergenic
1202257535 Y:22937609-22937631 TGTGGTCACCAAAGTGTGTCTGG - Intergenic
1202395541 Y:24420306-24420328 TGTGATTGCCAAAATGCGTCTGG - Intergenic
1202410525 Y:24571356-24571378 TGTGGTCACCAAAGTGTGTCTGG - Intergenic
1202460256 Y:25098716-25098738 TGTGGTCACCAAAGTGTGTCTGG + Intergenic
1202475243 Y:25249786-25249808 TGTGATTGCCAAAATGCGTCTGG + Intergenic