ID: 957383554

View in Genome Browser
Species Human (GRCh38)
Location 3:79466889-79466911
Sequence GAATATATCCAGAGGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957383554 Original CRISPR GAATATATCCAGAGGAAGCT TGG Intronic
900923105 1:5686092-5686114 GAATGGATCCAGAGCAGGCTTGG + Intergenic
902584807 1:17432240-17432262 GCAGATAACCAGGGGAAGCTAGG - Intronic
903066710 1:20703701-20703723 GAATAGATGGAGAGGAAGGTGGG + Intronic
903074234 1:20750066-20750088 GAAAATATCCATAGGAGGGTTGG - Intronic
905145596 1:35884544-35884566 AAAGATATCCAGTGGAAGATAGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
908037304 1:60069776-60069798 GAATATCACCACAGGAATCTTGG - Intronic
908700027 1:66888994-66889016 GAATATCTACAGAGAAAGCTGGG + Intronic
909065233 1:70928336-70928358 GAAGAAATGAAGAGGAAGCTGGG + Intronic
911183782 1:94883910-94883932 GAATATACACAGAGGAAGAAAGG - Intronic
912423438 1:109564502-109564524 GAAAAGATTCAGAGGAAGGTTGG - Intronic
912814690 1:112819738-112819760 GATTAACTGCAGAGGAAGCTGGG - Intergenic
913443080 1:118920201-118920223 CAAAATATCAAGAGGAAGATTGG + Intronic
915121142 1:153630125-153630147 AAATAGAGCCAGAGGAAGCATGG + Intronic
915300254 1:154947611-154947633 GAATGTCTCCAGAGGCAGGTGGG - Intronic
916028802 1:160858816-160858838 AAATATATCCAGAGAAAGAATGG + Intronic
918117879 1:181512175-181512197 GAATATAGTATGAGGAAGCTGGG + Intronic
918768622 1:188522952-188522974 GGTTATATCCAGAGAAATCTTGG - Intergenic
919697369 1:200591636-200591658 GAATTTAGCCAGAGGAAGACTGG - Intronic
920680630 1:208069744-208069766 AGATATAACCAGAGGAAGATAGG - Intronic
921922120 1:220681930-220681952 AAATATATTCAGAGGAATATTGG - Intergenic
923694349 1:236232533-236232555 GAATATGTCCTGAGGAAGTGGGG - Intronic
923872127 1:238006821-238006843 AAATATAAACAGAGAAAGCTTGG - Intergenic
924083222 1:240420911-240420933 GAAGGGAGCCAGAGGAAGCTGGG + Intronic
1063709001 10:8458855-8458877 ACATTTATCCAAAGGAAGCTGGG - Intergenic
1063756003 10:9009215-9009237 AAATCTATCCGGATGAAGCTTGG + Intergenic
1064128340 10:12684752-12684774 GAATATATTCAGAAGATGTTGGG + Intronic
1064171481 10:13037664-13037686 CAAGATATCCAGAGGAGGCCAGG + Intronic
1065751129 10:28888351-28888373 GTATACATCCACAGGAAGCAAGG - Intergenic
1068582339 10:58755989-58756011 AAATAAATCCAGAGGAAAATGGG - Intronic
1070401603 10:76057649-76057671 GAGTATATGCTGAGGAGGCTGGG + Intronic
1072212048 10:93255049-93255071 GAATATATCCAAAAGAATCCAGG + Intergenic
1074680648 10:115903784-115903806 AAATGTATCCAGAGGAACTTGGG + Intronic
1076295183 10:129378447-129378469 GGAGATGTCCAGAGGCAGCTAGG - Intergenic
1076350214 10:129810419-129810441 GAAAATATCCAGAGTAAGTCTGG - Intergenic
1078376370 11:10796629-10796651 GAATTTTTCCAGAGGAAGCAGGG + Intergenic
1078911493 11:15736790-15736812 GAAGATATCGAGAGGAAGGTAGG + Intergenic
1082728724 11:56769038-56769060 TAAAATATCCAGGGGATGCTTGG + Intergenic
1083892449 11:65602817-65602839 GAAAATAGCAAGAGCAAGCTGGG + Intronic
1084270165 11:68025025-68025047 GAAAGTATCCAGATGAAGCAGGG - Intronic
1084347216 11:68561389-68561411 AAAAATATTCAGAGAAAGCTGGG - Intronic
1086319434 11:85629041-85629063 CAATCTAGCCAGAGGAAGCGTGG - Intronic
1087250013 11:95888455-95888477 GAGTCTATCCAGAGGGAACTTGG - Intronic
1089343308 11:117774168-117774190 GAAGAATTCCAGAGGAATCTGGG - Intronic
1097909096 12:64949825-64949847 GAATATTTCCACTGGAAGGTTGG - Intergenic
1098196171 12:68004371-68004393 GGGAAGATCCAGAGGAAGCTTGG - Intergenic
1099839975 12:87953184-87953206 GCATAAAGCCAGAGGAAGCAGGG - Intergenic
1101276988 12:103213703-103213725 AAATCTGTCCAGAGGAATCTAGG + Intergenic
1103570497 12:121841406-121841428 GAATATATCTAGGAGTAGCTAGG - Intronic
1106909577 13:34449150-34449172 GAATAAAGACAGAGGAAACTAGG + Intergenic
1107006512 13:35618647-35618669 TAATTTATCCACATGAAGCTAGG + Intronic
1107052958 13:36072053-36072075 GAAGAAATGGAGAGGAAGCTGGG - Intronic
1109068686 13:57735341-57735363 TAATATATCCCCAGGAAGTTGGG - Intergenic
1110162314 13:72393184-72393206 GAACATTTCCAGAGCATGCTAGG + Intergenic
1114428568 14:22640814-22640836 GAAAATATCAAGAAGAGGCTGGG - Intergenic
1117149184 14:52867884-52867906 GAATAGATACTGAGGAAGTTTGG - Intronic
1119980766 14:79078444-79078466 GAATGTATGCAGAGCAAGGTTGG - Intronic
1120352356 14:83379059-83379081 AAATATATACAGAGGAAGGTTGG - Intergenic
1121163954 14:91774066-91774088 GTGAAGATCCAGAGGAAGCTAGG + Intronic
1121499954 14:94427165-94427187 GAAAGTTTCCAGAGGAAGCTGGG + Intergenic
1129482728 15:75840899-75840921 GAAAATATCCAGAGGCAGAAAGG - Intergenic
1131370117 15:91873813-91873835 AAATAGTTCCAGAGAAAGCTAGG - Intronic
1131520222 15:93108895-93108917 GAATATAATCGGAGGAAGCCAGG - Intergenic
1137572086 16:49573242-49573264 GAACATGTCTAGAGGATGCTGGG + Intronic
1139169904 16:64617235-64617257 GAATAGAAGCAGAGGAGGCTGGG + Intergenic
1139936255 16:70573486-70573508 GCAGACTTCCAGAGGAAGCTCGG - Exonic
1145859020 17:28191384-28191406 TATTATATCCAGGGGAAGGTCGG + Intronic
1149839765 17:59950873-59950895 CAATATATCTAGTGTAAGCTGGG + Intronic
1150271366 17:63867618-63867640 GATTATCTCCAGAGGAAGAGTGG + Intergenic
1150274900 17:63890488-63890510 GATTATCTCCAGAGGAAGAGTGG + Intergenic
1150277033 17:63905254-63905276 GATTATCTCCAGAGGAAGAGTGG + Intergenic
1150295825 17:64006881-64006903 GAATCCAGGCAGAGGAAGCTGGG + Intronic
1151088954 17:71413293-71413315 GATTATTTCCAGAGGAAGGAGGG + Intergenic
1152854629 17:82657815-82657837 GAATCTCTCCAGGAGAAGCTCGG - Exonic
1155434290 18:25795331-25795353 GAATCTATGCAGCGTAAGCTCGG - Intergenic
1158958130 18:62561826-62561848 GAATTCATGCAAAGGAAGCTAGG - Intronic
1159135752 18:64335038-64335060 AAATATATCCAGAGAAATGTTGG - Intergenic
1159580997 18:70234697-70234719 GAAAATATCCAGAGGCAGGATGG - Intergenic
1162238855 19:9331378-9331400 AAATAATTCCAAAGGAAGCTAGG - Intronic
1162239022 19:9333405-9333427 AAATAATTCCAAAGGAAGCTAGG + Intronic
926110154 2:10177531-10177553 GAATGGATGCAAAGGAAGCTAGG - Intronic
927336389 2:21929569-21929591 GATTACAACCAGAGCAAGCTTGG + Intergenic
930308693 2:49709996-49710018 GAAAATATCCAAAAGAAGCAAGG - Intergenic
932020746 2:68083586-68083608 GAATATATCATGAGGAACCAAGG + Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
934630431 2:95914129-95914151 GAATATAGCCAGAGGAAAAGAGG - Exonic
934803622 2:97194874-97194896 GAATATAACCAGAGGAAAAAAGG + Exonic
934803905 2:97198615-97198637 GAATATAGCCAGAGGAAAAAAGG + Exonic
934804320 2:97204220-97204242 GAATATAGCCAGAGGAAAAAAGG + Exonic
936692449 2:114906684-114906706 GAATTTATCCTGAGGATGCAAGG - Intronic
937818496 2:126280528-126280550 GAATATAATAAGAGGAAGCCTGG - Intergenic
939394884 2:141615897-141615919 TAATATATTCTGCGGAAGCTTGG - Intronic
940664763 2:156594738-156594760 TATAATATCCAGAGGAAGCCAGG + Intronic
940927750 2:159385685-159385707 TAAAATATCCAGATGAAACTTGG - Intronic
941244244 2:163077519-163077541 GAAGATCTGCAGAGGAAGCTTGG - Intergenic
941547074 2:166864929-166864951 GAGTATATCCAAAGGCAGCAAGG + Intergenic
942969653 2:181942478-181942500 GAATATATCCTTAGGAGTCTTGG - Intergenic
943459176 2:188148896-188148918 GTAGCTATCCAGAGGTAGCTTGG + Intergenic
944695688 2:202198429-202198451 GAATACTTCCAGATGAAGTTAGG + Intergenic
944787577 2:203088859-203088881 GCAAAAATCCAGAAGAAGCTAGG - Intronic
948784323 2:240343632-240343654 GAAGACTTCCAGAGGAAGCTGGG + Intergenic
948904926 2:240975221-240975243 GAATAGATGCAGAGGCAGCAGGG + Intronic
1174581322 20:51573862-51573884 GAGCATATCCTCAGGAAGCTGGG - Intergenic
1174993189 20:55536007-55536029 GAATATTTCAAGAAGGAGCTTGG - Intergenic
1179164069 21:38921758-38921780 GAATATATCTTGAGGACTCTGGG + Intergenic
1181339955 22:22170816-22170838 AAATATATCAAGAGGTAGCCAGG - Intergenic
1183289205 22:36988801-36988823 GATTATATGCATAGGAAGCTGGG - Intergenic
949791113 3:7793046-7793068 GAAAAACTCCAAAGGAAGCTGGG + Intergenic
951252011 3:20404743-20404765 GAATATATCCAGATGCTGCTTGG + Intergenic
952152143 3:30605261-30605283 CAAAACATCCAGAGGCAGCTTGG + Intergenic
956606505 3:71078125-71078147 GAAAATATACAGAGGAGGCCGGG - Intronic
957383554 3:79466889-79466911 GAATATATCCAGAGGAAGCTTGG + Intronic
960839767 3:121945267-121945289 TAAAATATACAAAGGAAGCTAGG + Intergenic
962559811 3:136593402-136593424 GAGGATATCCAGAGGGTGCTTGG + Intronic
963327427 3:143877527-143877549 GAAGAGATCCAGAGGAGACTGGG + Intergenic
966582099 3:181579332-181579354 GAATGTATTCAGAGGAATGTTGG - Intergenic
969043134 4:4316749-4316771 GCATATAACCAGAGGAAACTCGG + Intronic
969944876 4:10773066-10773088 AAATACCTCCAGAGCAAGCTGGG + Intergenic
971544973 4:27873912-27873934 AAAAATATCCAAAGCAAGCTTGG + Intergenic
971761853 4:30776070-30776092 GAACAAATCCAGAGGAAAATGGG - Intronic
973173190 4:47170667-47170689 TAGTATTTGCAGAGGAAGCTTGG + Intronic
973581452 4:52348360-52348382 ACATATATCCAGAGGAGCCTTGG - Intergenic
974369440 4:60995920-60995942 GAATATATCCAGAGAAAATTAGG + Intergenic
975160964 4:71122916-71122938 AAATAAATCCAGAGGAATCAGGG + Intergenic
975752463 4:77538126-77538148 TAAAATATCCAGAGGTATCTTGG - Intronic
976919297 4:90417618-90417640 GTATATATCCAAAGGAAAATGGG + Intronic
977223818 4:94370928-94370950 GATTATTTCCAAAGGAATCTTGG - Intergenic
977693275 4:99939487-99939509 GAAAATGTCCAGAGGAACCATGG - Intronic
978754055 4:112284618-112284640 GAATATATTCAGGGGGAACTGGG - Intronic
979119819 4:116883604-116883626 GAATCTATCAAGAGGAAGAAAGG + Intergenic
980349763 4:131669803-131669825 GAATATTTTCAGAGGAAGGAAGG - Intergenic
980474328 4:133292032-133292054 GCATATATCAAGAGAAAGCTGGG + Intergenic
980563716 4:134509870-134509892 GAATAGATCCATAGGAAACAGGG - Intergenic
981628538 4:146790044-146790066 GAAGATATCCAGATAAAGCAAGG - Intronic
983617826 4:169727259-169727281 GAATGTATCTTCAGGAAGCTGGG - Intergenic
983729985 4:170980701-170980723 GAATTTATCCTTAGGATGCTAGG - Intergenic
983952548 4:173659813-173659835 GAATATTTCCAGAGGCATTTTGG + Intergenic
984357223 4:178677470-178677492 CAATATTTCAAGAGGAAACTTGG + Intergenic
985683117 5:1266945-1266967 GATCCTATCCACAGGAAGCTGGG + Intronic
986148386 5:5102798-5102820 GCAAGAATCCAGAGGAAGCTAGG + Intergenic
986840584 5:11692525-11692547 GAATAGCTCAAGAGGCAGCTGGG + Intronic
987957121 5:24754557-24754579 GAATATATCAAGTGGAAGAAAGG - Intergenic
989745394 5:44822843-44822865 AAATAGATGCACAGGAAGCTGGG + Intergenic
990988312 5:61661318-61661340 GAGTATATCCAGAGGTTACTGGG + Intronic
991908650 5:71538144-71538166 GAATTTATCCTGGGGAAGCAAGG - Intronic
992534304 5:77683034-77683056 GTATCTACCCAGAGGAAGCGAGG - Intergenic
994037280 5:95216322-95216344 TGATACATCCATAGGAAGCTTGG + Intronic
994626370 5:102225191-102225213 GAATAGATCCAGAAGTAGTTTGG - Intergenic
995372953 5:111440041-111440063 GAGTATAGCCAGAGAAAGCTGGG + Intronic
1000172844 5:158720415-158720437 GAATAAACACAAAGGAAGCTGGG - Intronic
1000994988 5:167949772-167949794 GGATATATACAGAGGAATGTGGG - Intronic
1002951549 6:1817692-1817714 CAATAGCTCCAGATGAAGCTGGG + Intronic
1005223315 6:23613344-23613366 GAAGATATACAGAGGGAGCCAGG + Intergenic
1008735193 6:54534726-54534748 GAATATATGCAGTGTAAGTTTGG - Intergenic
1010813659 6:80329450-80329472 GAATATATACAGGGGTAGCTAGG - Intronic
1012249343 6:96962432-96962454 CAAGCTCTCCAGAGGAAGCTGGG - Intronic
1013257552 6:108403649-108403671 CAAAATATAAAGAGGAAGCTAGG + Intronic
1014296023 6:119619105-119619127 GAATATATGCAGAGTTACCTGGG - Intergenic
1021606296 7:22412689-22412711 GAATCTCTCAAGAGGAATCTGGG - Intergenic
1024115190 7:46186216-46186238 AAATATAACCAGAGAAAGCTAGG - Intergenic
1026378403 7:69774880-69774902 TGATATCTCCAGAGGAACCTAGG + Intronic
1026907746 7:74072374-74072396 GAATATATCCAGAGTTGGCCAGG + Intergenic
1028703653 7:93813146-93813168 GAATTTAGACAGAGGATGCTGGG - Intronic
1033380204 7:140809488-140809510 GAATATTCCCAGAGGAAACAGGG - Intronic
1034310451 7:150083239-150083261 CAAAATATCTAGAGGAGGCTGGG - Intergenic
1034796391 7:154017402-154017424 CAAAATATCTAGAGGAGGCTGGG + Intronic
1035172936 7:157029986-157030008 GAAAATATGCAGAGGAATCATGG + Intergenic
1036047583 8:5160887-5160909 GAATAAATCCAGAGGAGGAAAGG - Intergenic
1037490779 8:19395291-19395313 GAGTATATCCAGGGGAGGCCAGG - Exonic
1039197211 8:35046222-35046244 GAATTTATACAAAGGAAGCTGGG + Intergenic
1044388517 8:91620280-91620302 GAATATTTTCAGAGGAAACCTGG + Intergenic
1044436604 8:92171366-92171388 GAAGATATGCAGATCAAGCTGGG + Intergenic
1045670862 8:104552026-104552048 GAATGTATAAAGAGAAAGCTAGG + Intronic
1045931538 8:107633019-107633041 TAATCTATGCAGAGGAATCTTGG - Intergenic
1046304755 8:112350712-112350734 GAATATATTAAAAGGAAACTTGG - Intronic
1047849000 8:128836147-128836169 GATTATATCCAGTGGAATATAGG + Intergenic
1048174928 8:132143095-132143117 GAACAGATCCAGAGGAAGTCAGG - Intronic
1048440449 8:134455658-134455680 ACATATCTCTAGAGGAAGCTCGG + Intergenic
1050609404 9:7336066-7336088 AAAGATATCCAGATGAGGCTTGG + Intergenic
1052948805 9:34190941-34190963 TAATATATCCAGAGCAGGCTGGG - Intronic
1053542107 9:38984616-38984638 GAATAGATCCAAAGGAGGGTTGG - Intergenic
1053783006 9:41630269-41630291 GAATATTTTCAGAGGAAGGAAGG + Intergenic
1053806562 9:41808134-41808156 GAATAGATCCAAAGGAGGGTTGG - Intergenic
1054170959 9:61840411-61840433 GAATATTTTCAGAGGAAGGAAGG + Intergenic
1054624033 9:67379295-67379317 GAATAGATCCAAAGGAGGGTTGG + Intergenic
1054666577 9:67740401-67740423 GAATATTTTCAGAGGAAGGAAGG - Intergenic
1055180840 9:73384550-73384572 GAATTTATCCAGGGGATGCAAGG - Intergenic
1056740247 9:89248375-89248397 GAATGTCTAAAGAGGAAGCTGGG + Intergenic
1059428672 9:114236955-114236977 GAAGAGATCCAGAGCAGGCTGGG - Intronic
1187838583 X:23460838-23460860 GAATATAACAAGAGGAATTTTGG - Intergenic
1187866973 X:23731774-23731796 GACTATATCCAAAGGAAGTATGG + Intronic
1187933995 X:24318392-24318414 GAGGATATCCAGCGGGAGCTCGG + Intergenic
1188997135 X:36899365-36899387 AAATATATCCCCAGGCAGCTGGG + Intergenic
1189120413 X:38388235-38388257 GATTCTATCCAGGGGAACCTAGG - Intronic
1189264838 X:39706401-39706423 TAATATAGCCATAGGAAGCTAGG + Intergenic
1192465154 X:71349716-71349738 GATGATACCTAGAGGAAGCTGGG + Intergenic
1192473135 X:71416773-71416795 GATGATACCTAGAGGAAGCTGGG - Intronic
1193212716 X:78826558-78826580 GAATATCTCTTGAGGAAGTTAGG + Intergenic
1193874035 X:86838237-86838259 GAATATATCCAGCAGACACTTGG - Intergenic
1194490917 X:94548270-94548292 GGATATATGCAAAGGAAGCAAGG - Intergenic
1194495045 X:94604444-94604466 GAATTTAGCCAGAGGAAGAGAGG + Intergenic
1195151129 X:102071571-102071593 GAAAATATTCTGAGGAAGGTAGG + Intergenic
1197066670 X:122241286-122241308 GAATATATATATAGAAAGCTTGG + Intergenic
1197450655 X:126611362-126611384 GAATATATCATGATGAAGTTGGG + Intergenic
1198089832 X:133317324-133317346 GTATATATCCTGAGGAAGGCAGG - Intronic