ID: 957384055

View in Genome Browser
Species Human (GRCh38)
Location 3:79472279-79472301
Sequence GTTTAGGATTAGAAATTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957384049_957384055 9 Left 957384049 3:79472247-79472269 CCACAATCCTGCCCAATGTCACA 0: 1
1: 0
2: 2
3: 26
4: 202
Right 957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 189
957384047_957384055 29 Left 957384047 3:79472227-79472249 CCAACTTCATGGGCAATTTCCCA 0: 1
1: 0
2: 0
3: 13
4: 143
Right 957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 189
957384052_957384055 -3 Left 957384052 3:79472259-79472281 CCAATGTCACACTTCCTAGTGTT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 189
957384051_957384055 -2 Left 957384051 3:79472258-79472280 CCCAATGTCACACTTCCTAGTGT 0: 1
1: 0
2: 1
3: 19
4: 208
Right 957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 189
957384048_957384055 10 Left 957384048 3:79472246-79472268 CCCACAATCCTGCCCAATGTCAC 0: 1
1: 0
2: 0
3: 14
4: 157
Right 957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 189
957384050_957384055 2 Left 957384050 3:79472254-79472276 CCTGCCCAATGTCACACTTCCTA 0: 1
1: 0
2: 3
3: 19
4: 267
Right 957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957384055 Original CRISPR GTTTAGGATTAGAAATTCAG AGG Intronic
900551550 1:3259006-3259028 GTTTTGGACGAGAAATGCAGAGG + Intronic
901717509 1:11168344-11168366 GTTAAGACTTAGAAGTTCAGAGG - Intronic
903051128 1:20602018-20602040 GGTTAGGATGAGAAGATCAGTGG + Intronic
905743877 1:40396408-40396430 ATTTAAAATTAGAAAATCAGAGG - Intronic
906194305 1:43920456-43920478 GTTGAGGATTCGAATCTCAGGGG - Exonic
907696778 1:56738868-56738890 GTTTGGGAAGAGAAGTTCAGGGG + Intronic
909869094 1:80716763-80716785 CTATAGAATTACAAATTCAGTGG + Intergenic
910531141 1:88236896-88236918 ATTTTGGATTTAAAATTCAGAGG - Intergenic
910958823 1:92738848-92738870 GTTGAGGAAAAGAGATTCAGAGG - Intronic
911934426 1:103950358-103950380 GTTCATGATTAGAAAGTCTGTGG - Intergenic
912216057 1:107614013-107614035 ATTTAAGATTAGAAATTCTCAGG + Intronic
916143527 1:161720818-161720840 GTGAAGAATTAGAAATTCTGGGG + Intergenic
917168543 1:172143330-172143352 GTTTCGGAATAGAAATTAATGGG + Intronic
919718188 1:200802163-200802185 GTTTAGAAATAGTAATTCAATGG + Intronic
920264037 1:204708579-204708601 ATTTAGGCTTGGAATTTCAGGGG + Intergenic
921169323 1:212532427-212532449 GCTGAGTATTAGAAATTAAGTGG + Intergenic
921609942 1:217200042-217200064 ATTTAGGAGTAGAAATTCTGGGG + Intergenic
922362336 1:224834677-224834699 GTTTAGGATGAGAATTTGAGAGG - Intergenic
922829406 1:228543952-228543974 GTCTATCATTAGAAAGTCAGCGG + Intergenic
923212764 1:231820336-231820358 TTTGAGGGTTAAAAATTCAGAGG + Intronic
1063603067 10:7499527-7499549 GTTTTAAATTATAAATTCAGTGG + Intergenic
1063950705 10:11220637-11220659 GTTTATGTTGAGAATTTCAGGGG - Intronic
1064052796 10:12072708-12072730 GTTTAGGAGTAGTGATTCATGGG + Intronic
1068467250 10:57410325-57410347 GTTGAGTATATGAAATTCAGGGG - Intergenic
1068632149 10:59309180-59309202 ATTTGGGATAAGAAATTGAGAGG - Intronic
1069960345 10:72075574-72075596 ATTTATGATTAGAAATTTGGGGG + Intronic
1070054928 10:72925288-72925310 GTCTAGGAAGAGAAATTCAGTGG + Intronic
1071204566 10:83259109-83259131 GTTTAGGCATAGAGATTCGGTGG + Intergenic
1071250361 10:83812214-83812236 GTTTAGGACATGAACTTCAGAGG - Intergenic
1071273810 10:84034333-84034355 AATTAGCATTAAAAATTCAGTGG - Intergenic
1071591078 10:86873676-86873698 GATTAGGATTGGAAATACACTGG + Intronic
1074378290 10:112957047-112957069 TTTCAGGAATGGAAATTCAGTGG + Intronic
1079864000 11:25712070-25712092 TTTTATAATTAGAGATTCAGTGG - Intergenic
1080970384 11:37267601-37267623 TTTTGGTATTAGAGATTCAGAGG + Intergenic
1081001208 11:37674824-37674846 GTTGAGAAATAGAAATTCTGTGG + Intergenic
1082216251 11:49573401-49573423 CTTTAAAATTAAAAATTCAGGGG + Intergenic
1085538715 11:77245614-77245636 TTCTAGGATTAGTACTTCAGAGG - Intronic
1086011807 11:82113589-82113611 GTTTAGGAAGAGAACATCAGAGG - Intergenic
1086512329 11:87572460-87572482 GTTTAGGATGAACAATTAAGAGG + Intergenic
1086633333 11:89051081-89051103 ATTTAAAATTAAAAATTCAGGGG - Intronic
1087585737 11:100119143-100119165 GTTTAGGATAATATCTTCAGTGG - Intronic
1088185609 11:107165173-107165195 GTTTAATATTTGAAAGTCAGTGG - Intergenic
1092676654 12:10928478-10928500 GTTTAGGTCTAGAAATTCCTTGG + Intronic
1093774892 12:23062149-23062171 GTTTATGTTTAAAAATGCAGTGG + Intergenic
1094561563 12:31558804-31558826 TTTTAGCATTTGAAATTCTGTGG + Intronic
1095178361 12:39118898-39118920 GTTGAGGAATAGAAATACAGAGG - Intergenic
1096456890 12:51794848-51794870 GTCTTGGATTATAAATTCTGTGG + Intronic
1096900959 12:54881587-54881609 GTTTAGAATGAGAAATTGATAGG + Intergenic
1098873587 12:75843779-75843801 GTCTAGGAGAAGAGATTCAGGGG + Intergenic
1102371716 12:112387387-112387409 CTTTAGTTTTAGCAATTCAGTGG - Intergenic
1103865207 12:124046066-124046088 GTAAAGGAAAAGAAATTCAGGGG - Intronic
1104406369 12:128520536-128520558 GTTGAGGCTAAGAAATTCTGTGG - Intronic
1105546901 13:21357384-21357406 GTTGAGGATCACCAATTCAGAGG - Intergenic
1107231129 13:38112118-38112140 ATTTAAGATTAAAAATTGAGGGG + Intergenic
1107612509 13:42130417-42130439 GTTAAGCACAAGAAATTCAGAGG + Intronic
1107651606 13:42550657-42550679 TTTTTGACTTAGAAATTCAGTGG - Intergenic
1107945076 13:45410865-45410887 GTTTAGGGTTCGAAGTTTAGTGG - Intronic
1108321507 13:49295168-49295190 GTTTAGATATAGACATTCAGGGG - Intergenic
1109591455 13:64489392-64489414 TTTTAAAATTAGAAATACAGAGG + Intergenic
1111266231 13:85818666-85818688 ATTTAGTATTATAAATTCATTGG + Intergenic
1112101471 13:96194327-96194349 GATTATGTTTAAAAATTCAGAGG - Intronic
1115378126 14:32701561-32701583 GAATAGAATTAGAAATTCTGAGG + Intronic
1125704473 15:41721165-41721187 CTTTAAAATAAGAAATTCAGAGG + Intronic
1126563068 15:50065977-50065999 ATTTAGGAATAGAAATTCAGAGG + Intronic
1126582041 15:50250864-50250886 CTTTTGGATTAGAATTGCAGCGG - Intronic
1127269967 15:57391511-57391533 GTGTGGGATTATAAATTCACTGG + Intronic
1127733672 15:61822201-61822223 TTTTAGGCTTTGAAAATCAGAGG + Intergenic
1130186322 15:81687202-81687224 CTTGTGGATTAGAAATTCAGTGG + Intergenic
1136681197 16:31963841-31963863 GGTTATGATCAGAAATCCAGAGG - Intergenic
1136781509 16:32905353-32905375 GGTTATGATCAGAAATCCAGAGG - Intergenic
1137004787 16:35265041-35265063 GTTTTGGATAAGACATTCTGGGG + Intergenic
1137027647 16:35494305-35494327 GTTTTGGATAAGACATTCTGGGG + Intergenic
1138054292 16:53815950-53815972 GTTTAGGGTCAGAAAGTCAATGG - Intronic
1140160726 16:72490055-72490077 GATTATGATCAGAAATTCATGGG + Intergenic
1143722680 17:8823644-8823666 GATTGGGAGTGGAAATTCAGTGG - Intronic
1147036851 17:37688056-37688078 CTTTAGCATAAGAAACTCAGAGG + Intronic
1148149637 17:45389020-45389042 GTTTAGGGGAAGAAACTCAGTGG + Intergenic
1149173104 17:53836513-53836535 TTTTAGGAAAATAAATTCAGGGG - Intergenic
1149403291 17:56321134-56321156 TTTGGGGATTAGAAATTGAGAGG + Intronic
1150746132 17:67818304-67818326 GTTAAGGCTCAGAAAGTCAGAGG - Intergenic
1151030888 17:70737536-70737558 ACTTAGGATTAGAAATACAGGGG + Intergenic
1151087376 17:71396168-71396190 GTTTAGAAGTTGTAATTCAGAGG + Intergenic
1156624048 18:38887022-38887044 GTCTAAGATAAGAAAGTCAGAGG - Intergenic
1157043191 18:44063521-44063543 GTTTAGGATTGCTGATTCAGGGG + Intergenic
1158211337 18:55053899-55053921 GTTTAGGATTAAAAATGGTGTGG + Intergenic
1163527760 19:17831519-17831541 GCTCAGGATCAGAACTTCAGTGG - Intronic
925378046 2:3402659-3402681 CTTTAAGATTATAAATTCATTGG - Intronic
926059341 2:9795421-9795443 GTTGTGGGTTAGGAATTCAGTGG + Intergenic
928466944 2:31531189-31531211 GGTTCAGATTAGAAATGCAGAGG + Intronic
928924630 2:36565283-36565305 GTTTTGGAAGAGAACTTCAGTGG - Intronic
929841331 2:45467087-45467109 CTGTAGGATCAGAAATTCAGGGG - Intronic
930324284 2:49895143-49895165 GTTTCTGATTACAAATTCATAGG + Intergenic
935250437 2:101255629-101255651 GTTTAGGGTAAGACATTTAGTGG + Intronic
935383477 2:102477611-102477633 TTTTATTATTAGTAATTCAGAGG + Intronic
940141645 2:150497710-150497732 TTTTATGATTATAAATTAAGTGG + Intronic
940477993 2:154191481-154191503 CTGTAGGAAGAGAAATTCAGAGG + Intronic
940827638 2:158431502-158431524 GTGTAGGATTATAAATTGACAGG - Intronic
941589223 2:167398073-167398095 GAATAGGATTTAAAATTCAGGGG - Intergenic
941662983 2:168214588-168214610 ATTTAAGATTAACAATTCAGTGG - Intronic
942789488 2:179743161-179743183 GTTGAGAATTAGAAACTTAGAGG - Intronic
944984334 2:205158048-205158070 GTTTAGGTTTAAAAATTTAATGG + Intronic
945746243 2:213722655-213722677 GTTTAGGACAAGCAATCCAGTGG + Intronic
947396412 2:229691393-229691415 ATTTAGGACTAGAAACTCAAAGG - Intronic
948359669 2:237411321-237411343 GTTTAGGACTTAAAATTCACCGG - Intronic
1169067752 20:2704032-2704054 TTTTTGGATTAGTGATTCAGGGG - Intronic
1169566619 20:6860669-6860691 GTACATGATTAGAAATTCATAGG + Intergenic
1169876144 20:10299057-10299079 CTTTAAGAATAGAAATTCAAGGG + Intronic
1169984303 20:11425562-11425584 GTTTTGTTTTAGAAAATCAGTGG - Intergenic
1171568234 20:26216735-26216757 GTTTGGGCTTTGGAATTCAGTGG - Intergenic
1175167096 20:57052057-57052079 ATTTAGGTTTAGAAATGGAGAGG + Intergenic
1177424749 21:20908176-20908198 GTTTAGGATTATACTTTGAGTGG + Intergenic
1177812509 21:25939418-25939440 GTATAGGATGAAAAATTAAGTGG - Intronic
1178235096 21:30832828-30832850 TGTAAGGAATAGAAATTCAGTGG - Intergenic
952775222 3:37039611-37039633 GTTTATGATTACACATTCACAGG + Intronic
957110624 3:75951603-75951625 GTTTGGGCTTTGGAATTCAGGGG + Intronic
957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG + Intronic
957638492 3:82817613-82817635 GGCTAGGATTTGAAACTCAGGGG - Intergenic
957814118 3:85270114-85270136 GTTTAGGAGTAAAATTTCTGAGG - Intronic
958541280 3:95476945-95476967 GGTTTGGATTTGAAATTCAAAGG + Intergenic
959386100 3:105709289-105709311 GATTAGGCTTATAAATTTAGGGG + Intronic
959986458 3:112578364-112578386 GTTTAGGAACAGAGATTCTGTGG + Intronic
960958889 3:123055213-123055235 CTGCAGAATTAGAAATTCAGGGG + Intergenic
962118542 3:132537300-132537322 GGTTAGGACTAGAAAGGCAGTGG - Intronic
962416663 3:135188798-135188820 GGTGAGGATTAGATATTAAGTGG + Intronic
962969486 3:140385675-140385697 GTTTAAGGTTAGAACATCAGGGG - Intronic
964131022 3:153286770-153286792 TTTGAGGATTACAGATTCAGTGG - Intergenic
964548761 3:157863735-157863757 GTTTAGGGGCAGAAATTAAGTGG - Intergenic
964553522 3:157910993-157911015 GTATAGGGTGAGAAAATCAGTGG + Intergenic
964637477 3:158872956-158872978 GTTTAGGTTGAGAAATTCACTGG - Intergenic
967973289 3:195015069-195015091 GTTTATGATAAGAAAGACAGTGG - Intergenic
973199151 4:47479951-47479973 AGTTAGGATTAAAAATTCATGGG - Intergenic
973976512 4:56268404-56268426 GTTTCTGATTAGAAATTTTGGGG + Intronic
974263373 4:59553731-59553753 TTTAAACATTAGAAATTCAGTGG + Intergenic
975558691 4:75689614-75689636 GTTTGGGAATTTAAATTCAGAGG - Intronic
977160134 4:93623714-93623736 ATTTAAGAATAGAAAATCAGTGG - Intronic
979287250 4:118940365-118940387 GTTTAGAAATAGAAAATTAGAGG - Intronic
979590277 4:122471048-122471070 GTTTAGGATTGCAAACTCAAAGG - Intergenic
980548930 4:134307752-134307774 CTTTAGGCTTAGAAGTTAAGAGG - Intergenic
981071745 4:140547744-140547766 GTTAAGGATTAGAAAATCATAGG - Intronic
982145508 4:152385177-152385199 GTTCAGGAAAAGAAATTCAGGGG - Intronic
982159513 4:152553679-152553701 CTTTAGCATTAGAAATTTGGGGG + Intergenic
983711199 4:170718473-170718495 CTTATAGATTAGAAATTCAGTGG - Intergenic
985145913 4:186894405-186894427 GTTAAGGATAAGAAGGTCAGGGG - Intergenic
985525725 5:400577-400599 TTGTAGGATTAGAAAGGCAGAGG + Intronic
988575001 5:32413452-32413474 GTCTAGGAGTAGAAATCTAGTGG + Intronic
989414261 5:41155220-41155242 TTTTAGAAGTAGAAATTGAGAGG - Intronic
990495098 5:56339177-56339199 GATTATGATTAGAAACTTAGAGG + Intergenic
990617149 5:57519718-57519740 GGTAAGGATTAGGAGTTCAGAGG - Intergenic
990655403 5:57949579-57949601 GTTTGGGACAAGAAATTCTGGGG + Intergenic
991579303 5:68137559-68137581 GGTTAGGAACAGAAAGTCAGTGG - Intergenic
993396655 5:87397759-87397781 GGGTAGGATTAGTAGTTCAGTGG + Intronic
993931118 5:93941504-93941526 GTGTATGATCAGAATTTCAGTGG - Intronic
994133752 5:96261747-96261769 ATTTAAAATTAAAAATTCAGGGG - Intergenic
995084650 5:108093486-108093508 GTTTCTTATTAGAAATTCAAAGG - Intronic
996867076 5:128136988-128137010 GGAAAGGATTAGAAATTAAGAGG - Intronic
997001624 5:129768662-129768684 GTTTGGAAGTAGAAATCCAGAGG - Intergenic
997486920 5:134239018-134239040 GTTTGGGGTTATAAATTCACAGG - Intergenic
999389829 5:151181946-151181968 TTCTAGGTTTAGAAGTTCAGAGG - Exonic
1005249580 6:23929218-23929240 GTTCAGGATAAGAAATTTTGTGG + Intergenic
1005474465 6:26194114-26194136 TTTTAAGATTAGAAATACATGGG + Intergenic
1005960240 6:30688601-30688623 GTTAAGGATTTAGAATTCAGTGG + Exonic
1007331547 6:41114172-41114194 GATTAGGAAGAGGAATTCAGAGG - Intergenic
1008507172 6:52242435-52242457 GAATAGGATTAGAAGTTGAGAGG - Intronic
1008703507 6:54129902-54129924 GGGTAGGATTAAAAATTTAGAGG + Intronic
1008815304 6:55557688-55557710 AAGAAGGATTAGAAATTCAGTGG - Intronic
1012205248 6:96453260-96453282 GTTTTGGATTAGGAATCAAGAGG + Intergenic
1012991615 6:105932003-105932025 GTTTAAGGTTATAAATTCATTGG + Intergenic
1013341754 6:109221728-109221750 GTTTAAGAATAGAAATTCCAAGG + Intergenic
1014963637 6:127718697-127718719 GATTAGTATTAGAAATTTGGAGG + Intronic
1015154121 6:130072657-130072679 TTTTAGGAGTAGGAATACAGAGG - Intronic
1015990461 6:138936178-138936200 GATTATGATTTCAAATTCAGCGG - Intronic
1020367530 7:7396210-7396232 AATTAGGATCAGAACTTCAGGGG - Intronic
1020515648 7:9114899-9114921 GTTTAGAATTAGTAAACCAGAGG + Intergenic
1021151643 7:17158700-17158722 CTTTGGGATTAGAAATCCAAAGG + Intergenic
1021784475 7:24138309-24138331 GTTTAGGAATAGAAAGTTACTGG - Intergenic
1030518500 7:110567065-110567087 TTTTAGGATGAGCCATTCAGTGG + Intergenic
1032104268 7:129012308-129012330 GTTTTGTATTAGAAATTCATTGG - Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1037211589 8:16394773-16394795 CTTTAGCATAAGAATTTCAGTGG + Intronic
1038696173 8:29808427-29808449 GTCCAGAAATAGAAATTCAGAGG + Intergenic
1039237743 8:35521137-35521159 GTTTTGGATTAGAAAAAAAGAGG + Intronic
1039935450 8:42040300-42040322 CTTCAGGAATAGAAATCCAGAGG - Intronic
1040909756 8:52505919-52505941 TTTTAGGAATAGAAATCGAGAGG - Intergenic
1041322600 8:56629829-56629851 ATATTGGATTAGAAATGCAGAGG - Intergenic
1042050224 8:64696033-64696055 ATTTAGCATTACAAACTCAGAGG - Intronic
1045682325 8:104676068-104676090 GTTATTAATTAGAAATTCAGGGG - Intronic
1045948947 8:107829932-107829954 GTTCAAGCTTAGGAATTCAGAGG - Intergenic
1048830798 8:138475369-138475391 GGTTGGAAGTAGAAATTCAGGGG - Intronic
1050882634 9:10722003-10722025 GCCTAGGATGAGAATTTCAGGGG - Intergenic
1055047320 9:71942594-71942616 GTTTATGATTTGAAACTCACAGG + Intronic
1056317045 9:85400240-85400262 GACTAGGATAAGAAGTTCAGTGG - Intergenic
1059701603 9:116780456-116780478 GTTTAGGATTAGCATTTCTGGGG + Intronic
1059980451 9:119765926-119765948 GATTAGCATTAGCCATTCAGGGG + Intergenic
1186082410 X:5947359-5947381 GTTTAGGATTAAAGATTCATAGG + Intronic
1187129191 X:16484796-16484818 GTCTAGGATTATAAACCCAGAGG - Intergenic
1188375592 X:29424382-29424404 CTTTAGGATTAAATATTCTGGGG - Intronic
1188479918 X:30627038-30627060 CTTTAGTATTAGAAATTTAATGG - Intergenic
1192048143 X:67698239-67698261 CTTTAGGATTAGAAGGTCAGAGG - Intronic
1192860594 X:75065451-75065473 GTTTAGGTATATAAATTCACAGG - Intronic
1194101068 X:89704701-89704723 CCTTAGCATTATAAATTCAGAGG - Intergenic
1194332970 X:92607571-92607593 ATTTAACATGAGAAATTCAGTGG - Intronic
1199459687 X:148070834-148070856 GTTTTGGATTGGGAATTCATAGG - Intergenic
1200454022 Y:3365785-3365807 CCTTAGCATTATAAATTCAGAGG - Intergenic
1200641665 Y:5726597-5726619 ATTTAACATGAGAAATTCAGTGG - Intronic
1201943849 Y:19488935-19488957 GTTTCTGCTTAGAAATTCACTGG - Intergenic