ID: 957387348

View in Genome Browser
Species Human (GRCh38)
Location 3:79514014-79514036
Sequence CTAACGGTCTAGAGAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957387348_957387354 19 Left 957387348 3:79514014-79514036 CCTTTTGTTCTCTAGACCGTTAG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 957387354 3:79514056-79514078 AACACACTTACCCCAATGTTGGG 0: 1
1: 0
2: 1
3: 8
4: 129
957387348_957387353 18 Left 957387348 3:79514014-79514036 CCTTTTGTTCTCTAGACCGTTAG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 957387353 3:79514055-79514077 CAACACACTTACCCCAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
957387348_957387358 30 Left 957387348 3:79514014-79514036 CCTTTTGTTCTCTAGACCGTTAG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 957387358 3:79514067-79514089 CCCAATGTTGGGGAGCAGCACGG 0: 1
1: 0
2: 2
3: 21
4: 199
957387348_957387355 20 Left 957387348 3:79514014-79514036 CCTTTTGTTCTCTAGACCGTTAG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 957387355 3:79514057-79514079 ACACACTTACCCCAATGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957387348 Original CRISPR CTAACGGTCTAGAGAACAAA AGG (reversed) Intronic
903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG + Intronic
905556219 1:38886794-38886816 TTAAAGGTCTAGAGAACTAGGGG + Intronic
908773764 1:67619809-67619831 TGAACAGTCTAGAGAACAAGGGG + Intergenic
909971198 1:81992159-81992181 CAAACTTTCTAGTGAACAAAAGG + Exonic
910725608 1:90335583-90335605 CTAATGGTGTTGAGAGCAAATGG + Intergenic
911616640 1:100019810-100019832 CTAACAGTCAATAGAATAAAGGG - Intronic
913158143 1:116120331-116120353 ATAAGGGACTAGAGAATAAAGGG - Intronic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
917136656 1:171794522-171794544 CTGAAGGTATGGAGAACAAAAGG + Exonic
919541296 1:198848342-198848364 GTAAAGGCCTAGAGAATAAAAGG - Intergenic
920203124 1:204272899-204272921 CTAAGGAACTAGAAAACAAATGG - Intronic
922387363 1:225100369-225100391 CTGACGATCTAGAGCAGAAATGG - Intronic
924626951 1:245703499-245703521 CAAACGGTCTACAGAACATACGG - Intronic
1066178173 10:32932467-32932489 CTAAATGACCAGAGAACAAATGG + Intronic
1066178608 10:32937740-32937762 CTAACAGTTTAAAAAACAAATGG - Intronic
1068599321 10:58938925-58938947 CTAATGATACAGAGAACAAAAGG + Intergenic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1078308335 11:10213638-10213660 CTATTGGTCTAGAGGCCAAAAGG + Intronic
1082192192 11:49259704-49259726 CTCACAGTCTAGAGGACAAAAGG + Intergenic
1083120559 11:60508812-60508834 CTAAGGGTCTGGAAAATAAATGG + Intergenic
1086673938 11:89581339-89581361 CTCACAGTCTAGAGGACAAAAGG - Intergenic
1087224774 11:95586331-95586353 CTCAGTGTCTTGAGAACAAATGG - Intergenic
1093308683 12:17550962-17550984 TTAAAGGTCTAGTGACCAAAAGG + Intergenic
1093556710 12:20484650-20484672 CTAACGTAATAAAGAACAAAAGG - Intronic
1095266559 12:40165950-40165972 TTAACAGACTAGAGAATAAATGG + Intergenic
1100903643 12:99272761-99272783 CAAATGGTCTAGAGAAGAAAGGG - Intronic
1101074413 12:101113526-101113548 CTAATGGATTAGAAAACAAAAGG - Intronic
1107759036 13:43656545-43656567 CTAAGTGTTTAGAGAACAAAAGG + Intronic
1111745382 13:92261769-92261791 ATAAAGGTTTGGAGAACAAAAGG + Intronic
1112330639 13:98474745-98474767 CTACCAGGCTAAAGAACAAAAGG + Intronic
1113084885 13:106558748-106558770 ATAACTCTCTAGAGAAAAAAAGG + Intronic
1151783518 17:76263562-76263584 CTAAAGGTCTGCAGAACAGAAGG - Intergenic
1154984571 18:21536704-21536726 CCAACAGTCTAGAGAACAAGAGG + Intronic
1161209694 19:3059965-3059987 CGAACGGTCTTGAGCACACAGGG + Intronic
928242500 2:29598554-29598576 CCATGGGTCTAGAGAGCAAAGGG + Intronic
929357758 2:41046339-41046361 CTAACAGGCTAGAGAAAAATGGG - Intergenic
929840479 2:45456392-45456414 TTAACTGTCAAGAAAACAAAAGG - Intronic
933422358 2:82065893-82065915 CTAGAAGTCTAGAGAAGAAACGG - Intergenic
934774805 2:96930409-96930431 CTCACGGTGCAGAGAACACATGG - Intronic
935464600 2:103381488-103381510 CTTATGGGCTAGAGGACAAATGG + Intergenic
941223196 2:162811119-162811141 CTAATGTTCTAGAGGGCAAAGGG - Intronic
943795558 2:191988590-191988612 CTGACTTTCTAGAGGACAAATGG + Intronic
1181321440 22:22009985-22010007 GGAGCGGTCTAGAAAACAAAAGG + Intergenic
1184914556 22:47560415-47560437 CTAACCTGCTAGAGAACAGATGG - Intergenic
951674376 3:25219995-25220017 ATAACTGTCTTTAGAACAAAAGG - Intronic
955002454 3:54939756-54939778 CTACTGGTCTATAGATCAAAGGG - Intronic
957387348 3:79514014-79514036 CTAACGGTCTAGAGAACAAAAGG - Intronic
961836572 3:129666199-129666221 CTAACAGTGTGGAGAAGAAATGG + Intronic
965175538 3:165325831-165325853 CTAATGGTCTGGAGAACTTACGG - Intergenic
965677904 3:171218283-171218305 CTAAAGGGGTAGATAACAAAAGG + Intronic
972046590 4:34672576-34672598 CTGACTGGCTAGAGAAGAAAAGG + Intergenic
974515959 4:62911281-62911303 CAAAAGGTCTAGTGAACAAGAGG - Intergenic
974572532 4:63671775-63671797 CTAAAGTTCTAGAGAAGCAAGGG - Intergenic
977781604 4:100987164-100987186 CTAACTCTCTAGACACCAAATGG + Intergenic
978151621 4:105442702-105442724 CTAACGGTCTAGACAGCTGAAGG + Intronic
979997942 4:127455237-127455259 CTAACGATCAATAGGACAAAAGG + Intergenic
985304595 4:188524624-188524646 CTAATAGTCTGGTGAACAAACGG - Intergenic
990148736 5:52791554-52791576 CCAACCTTCCAGAGAACAAAGGG + Intronic
992511170 5:77436687-77436709 CTAACTGTCAAGGGAAAAAAGGG + Intronic
993606131 5:89992699-89992721 CTAGGGTTCTAGAGAACCAAAGG - Intergenic
1001675879 5:173514915-173514937 CCAACTGGCTAGAGAATAAATGG - Intergenic
1007875215 6:45091509-45091531 CAAACTCTCTAGAGAAGAAATGG + Intronic
1008491014 6:52087354-52087376 TTAACGTTCTGGTGAACAAAAGG - Intronic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1035851968 8:2929399-2929421 GTAAAGGCCTATAGAACAAAAGG + Intergenic
1037613175 8:20493737-20493759 CTAAAGCTCTAGAGAAAACAAGG - Intergenic
1038919243 8:32064387-32064409 ATCACAGTCTAGGGAACAAATGG - Intronic
1043996709 8:86826546-86826568 TTAATGTTCTAGAGAAGAAATGG - Intergenic
1045921378 8:107534089-107534111 ATGATGATCTAGAGAACAAATGG - Intergenic
1047235742 8:123040631-123040653 CTAGCTGTCTAGAGAAAAGATGG + Intronic
1049484392 8:142846000-142846022 CTTATGGTCTAGAGATCACATGG - Intronic
1051476654 9:17516272-17516294 CTTACGGTCTATAGAAGAGATGG - Intergenic
1058039629 9:100289659-100289681 CTAACCTACTGGAGAACAAAAGG - Intronic
1058056633 9:100455354-100455376 CCAACTGTCTAGAGAAAAATTGG - Intronic
1189178624 X:38982520-38982542 CCAACTGTCTAGATAACACAGGG - Intergenic
1198987570 X:142473449-142473471 CTCACGGTGCAGAGGACAAAGGG - Intergenic