ID: 957392556

View in Genome Browser
Species Human (GRCh38)
Location 3:79595919-79595941
Sequence GTTGTTTATCTCACAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957392556_957392559 1 Left 957392556 3:79595919-79595941 CCTGTCCTTGTGAGATAAACAAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 957392559 3:79595943-79595965 AGAAAAGGTCAGCCCCATTGTGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957392556 Original CRISPR GTTGTTTATCTCACAAGGAC AGG (reversed) Intronic
900320437 1:2080908-2080930 CATGTTTTTCTCATAAGGACTGG + Intronic
900941966 1:5804701-5804723 GGTGATTCTCTTACAAGGACTGG - Intergenic
903317595 1:22520665-22520687 TTTGTTTAACTCACAGGGAAGGG + Intronic
906983738 1:50660343-50660365 GATATTTAGCTCACAAGGAATGG - Intronic
908087111 1:60647270-60647292 GTTGTTTCTCACAGAAGGATGGG + Intergenic
908336746 1:63133340-63133362 TTTGTTTAGCTCAAAAGTACAGG - Intergenic
910064055 1:83131566-83131588 ATTGTTTATTTCAAAAGGAGAGG - Intergenic
910365103 1:86456734-86456756 GTTGTTTTTCTCCCCAGCACTGG - Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
917464384 1:175262272-175262294 CTGGTTCATCTCACTAGGACTGG - Intergenic
917573727 1:176297111-176297133 TTGGTTTATCTCACTGGGACTGG - Intergenic
920435986 1:205947530-205947552 GGTCTTGATCTCCCAAGGACTGG - Intergenic
920651030 1:207837348-207837370 GTAGTTCATCTGCCAAGGACAGG - Intergenic
1064492938 10:15878559-15878581 TTGGTTCATCTCACAGGGACAGG - Intergenic
1065851297 10:29792135-29792157 GATGATTATCTCACATGGAAGGG - Intergenic
1070851805 10:79570488-79570510 GTGGTTCATCTCACTGGGACTGG + Intergenic
1071186999 10:83057849-83057871 GTTGGTGGTCTCACACGGACGGG + Intergenic
1075044675 10:119137368-119137390 TTAGTTTATCACATAAGGACTGG - Intronic
1079684464 11:23340268-23340290 GTTTTTTATCTCACTAGGCTTGG - Intergenic
1081324654 11:41729310-41729332 GTGGTTCATCTCACTGGGACTGG - Intergenic
1082968206 11:58989957-58989979 CTGGTTTATCTCATAGGGACAGG - Intronic
1083619689 11:64042662-64042684 GTTGTCTATCTCCCTGGGACCGG - Intronic
1084912509 11:72402320-72402342 TTTATTTATGTCACATGGACAGG - Intronic
1086495169 11:87396686-87396708 GTTGTTCATGTCACTAGCACTGG + Intergenic
1087546430 11:99590026-99590048 GAAGTTCATCTCTCAAGGACTGG - Intronic
1090517789 11:127447247-127447269 GTATTTTGTCTCTCAAGGACAGG - Intergenic
1090996371 11:131869343-131869365 GTTGTAAATCACACAATGACTGG - Intronic
1092610751 12:10169990-10170012 TTTGTTTATCTCACAAGGTGAGG - Intronic
1092963622 12:13620170-13620192 GTTATTTATCTGCCAAGGAAAGG + Intronic
1095103649 12:38206753-38206775 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1096610416 12:52797303-52797325 GCTGCTTATCTCTCCAGGACAGG + Intergenic
1098579504 12:72082389-72082411 GGTGTTTATTTCACAAGCATAGG + Intronic
1100997466 12:100317849-100317871 GTTCTTTATCTCATCAGGAGGGG - Exonic
1101526076 12:105532287-105532309 GTTTTTTTTCTCACCAGAACTGG + Intergenic
1101550582 12:105757711-105757733 GTTATTTATCTTCCTAGGACTGG + Intergenic
1103023500 12:117555244-117555266 GTTGTTGATGTCACACGGAACGG + Exonic
1104577733 12:129983294-129983316 GTTATTTATTTCACAAGGTCTGG + Intergenic
1104789720 12:131473911-131473933 GCAGTTGATCTCACAGGGACAGG - Intergenic
1106483484 13:30154142-30154164 GTTGTTTATCACGGAAGGGCTGG + Intergenic
1107043383 13:35971882-35971904 GTTGTTGTTTGCACAAGGACAGG + Intronic
1107282424 13:38751804-38751826 TTTTTTTTTCTAACAAGGACTGG + Intronic
1108318581 13:49263198-49263220 GTTGTTTATCTGAAAGTGACAGG - Intronic
1110071500 13:71184388-71184410 CTGGTTTATCTCACTGGGACTGG + Intergenic
1110853833 13:80276055-80276077 CTTGTTTATTTCACAAGGTTAGG - Intergenic
1112905485 13:104414773-104414795 GTGGTTTATCTCACAATGCCTGG + Intergenic
1116796195 14:49393022-49393044 CTGGTTCATCTCACAGGGACTGG + Intergenic
1123504947 15:20932680-20932702 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1123562192 15:21506374-21506396 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1123598437 15:21943661-21943683 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1125183686 15:36906853-36906875 GTTCTTTATCTGACCATGACTGG + Intronic
1126747307 15:51838989-51839011 GCTGTATATTTCACAGGGACTGG + Intronic
1128625046 15:69192897-69192919 GTTGTTTATCTTACAACTCCTGG + Intronic
1132287992 15:100679576-100679598 CTGGTTCATCTCACCAGGACTGG - Intergenic
1202970539 15_KI270727v1_random:233516-233538 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1135301814 16:21335060-21335082 TTGGTTTATCTCACTGGGACTGG - Intergenic
1140070015 16:71641057-71641079 ATTGTTTCTCTCAAAAAGACAGG + Exonic
1140104368 16:71946208-71946230 TTTTTTCATCTCACAAGGAATGG + Intronic
1140133113 16:72181542-72181564 TTTTTTAATCTCACAAGGAAGGG - Intergenic
1140792497 16:78405625-78405647 GTTTTTTATCTCTCAATGATTGG + Intronic
1146116478 17:30145123-30145145 AGTGTTTATCTCAGAAGGAATGG - Intronic
1146241289 17:31229444-31229466 GTTTTTTGACTCCCAAGGACAGG + Exonic
1149093923 17:52817566-52817588 CTGGTTTATCTCACTGGGACTGG - Intergenic
1154058768 18:11038021-11038043 GTTGTTTAACTCAGAAGTCCAGG - Intronic
1157709069 18:49836133-49836155 GTTATTTATCTTTCAGGGACTGG + Intronic
1163272559 19:16262926-16262948 GTTGTTTAGCTGAGAAGAACTGG - Intergenic
1166916533 19:46199287-46199309 GTTGTTTTTCTGACAAGTAAGGG - Intergenic
942578963 2:177395806-177395828 GTTGGTTATATCACATGGCCTGG + Intronic
945041109 2:205744640-205744662 CTTGTTTTTCTCAAAAGAACAGG + Intronic
1169595280 20:7191512-7191534 CTTGTTTATCTCAAAAGAATGGG + Intergenic
1170694584 20:18646945-18646967 GTGGTTCATCTCAGAAGGTCAGG - Intronic
951014869 3:17719780-17719802 GTTGTTTATATAACACAGACTGG - Intronic
951028396 3:17853781-17853803 ATTGTTTATCACACAAAGAAAGG - Intronic
951389170 3:22082177-22082199 CTGGTTTATCTCACTGGGACAGG + Intronic
951622553 3:24621174-24621196 GATATTTATATCACAAGTACTGG + Intergenic
952213279 3:31250746-31250768 TTTGTTTATTTCACAAGGAAGGG + Intergenic
953473791 3:43189057-43189079 GTTGTACATCTCATAGGGACCGG + Intergenic
957302831 3:78415220-78415242 GTTGTTTATGCCACAAGCACTGG + Intergenic
957392556 3:79595919-79595941 GTTGTTTATCTCACAAGGACAGG - Intronic
957893189 3:86386584-86386606 ATTTTTTATCTTACAAGGAGGGG + Intergenic
960913130 3:122669013-122669035 GTAGTTCATCTCACTGGGACTGG - Intergenic
962872840 3:139513130-139513152 GTTGGTTGTCTCTGAAGGACTGG + Intergenic
966710290 3:182965652-182965674 GTTGTCTTTCTCAAAATGACTGG - Exonic
966999995 3:185325289-185325311 GGGGGTTCTCTCACAAGGACAGG + Intronic
974115304 4:57571444-57571466 CTTGTTCATCTCACTGGGACTGG - Intergenic
974800895 4:66816485-66816507 GTTGTTTTTCTTATAATGACAGG + Intergenic
975365012 4:73518854-73518876 CTTGTTCATCTCACTGGGACTGG - Intergenic
976580564 4:86730822-86730844 CTGGTTCATCTCACAGGGACTGG - Intronic
976656428 4:87493344-87493366 GTTGTTTATTTAAGAAGCACAGG - Intronic
981254729 4:142648294-142648316 CTGGTTTATCTCACAGGGACTGG + Intronic
981948167 4:150374366-150374388 GTTGCTCATCTCAAAAGGAATGG + Intronic
986945282 5:13010803-13010825 GTTGTTTATTTCCTAATGACTGG + Intergenic
989614795 5:43328893-43328915 CTTGTTCATCTCACTGGGACTGG - Intergenic
990148190 5:52787257-52787279 GTTGTTCAACTCACCAGGAAAGG + Intergenic
990654528 5:57940315-57940337 GTTGCTAATCTCATAAGGCCTGG + Intergenic
991280822 5:64910970-64910992 GTGGTTCATCTCACTGGGACTGG - Intronic
997709145 5:135988891-135988913 ATTGTTTATATCAAAAAGACAGG - Intergenic
1000214240 5:159139646-159139668 CTGGTTTATCTCACTGGGACCGG + Intergenic
1001441394 5:171745993-171746015 GTTGAGTTTCTCAAAAGGACCGG - Intergenic
1007812160 6:44494130-44494152 GTTCTTTGTCTCAAAAGGATAGG - Intergenic
1008669462 6:53752582-53752604 ATTGTTTATTTCACAAGGTAGGG + Intergenic
1010282286 6:74035713-74035735 GTGGTTCATCTCATTAGGACTGG - Intergenic
1010820720 6:80411975-80411997 CTTGTTCATCTCACTGGGACTGG - Intergenic
1010964652 6:82190339-82190361 TCTCTTTCTCTCACAAGGACTGG - Intronic
1011278015 6:85648362-85648384 GTTGTATATCTCAAAATTACTGG + Intergenic
1012327254 6:97937001-97937023 CTTGTTTACCTACCAAGGACAGG - Intergenic
1012557338 6:100530359-100530381 GTTGTCTATCTCAAAATGACTGG + Intronic
1012699807 6:102440787-102440809 CTTGTTTATTTCAGAAGTACAGG - Intergenic
1013608735 6:111774533-111774555 GTTGTTGTCCTCACAAAGACTGG - Intronic
1027574451 7:79915172-79915194 CTTGTTCATCTCACTGGGACTGG + Intergenic
1028715561 7:93963112-93963134 GTTGTTGCTAACACAAGGACTGG + Intronic
1030295466 7:107921605-107921627 GTTGTTTAGCTGAAAAGGAATGG + Intronic
1030407098 7:109128747-109128769 GTTCTTGATCTCACATGGATGGG + Intergenic
1031142837 7:117963834-117963856 CTTGTTTTTCTCACATTGACTGG - Intergenic
1031310185 7:120186774-120186796 GTTTTTCATCTCACAAGCAGAGG - Intergenic
1031434322 7:121713491-121713513 CTGGTTCATCTCACTAGGACTGG - Intergenic
1033016662 7:137678438-137678460 GTTTTCCATCTCACAAGGACAGG + Intronic
1037333016 8:17763217-17763239 GGTGTGTAGATCACAAGGACAGG - Intronic
1037587156 8:20285229-20285251 GTTGATGAGCTCACAAGGGCAGG - Intronic
1038203773 8:25443781-25443803 GTTGTATATCTCAAAAGAAAAGG - Intronic
1038943648 8:32333114-32333136 GTTGTCTATCCCAAAAAGACAGG + Intronic
1041321047 8:56612735-56612757 GTTGTTTATATCCCAAGTATGGG - Intergenic
1041911380 8:63092286-63092308 GGTGTTAATCTCAGAGGGACTGG - Intergenic
1042456869 8:69015408-69015430 GTTGTGTTTCTCACAGGCACTGG + Intergenic
1043725115 8:83601819-83601841 CTGGTTTATCTCACTGGGACTGG + Intergenic
1047194349 8:122707998-122708020 GGTGATTATGTCACAAGGGCAGG - Intergenic
1047814718 8:128450564-128450586 GTTGTTTACCACACAAAGCCTGG + Intergenic
1050146818 9:2576965-2576987 CTTGTCTATCTCATAAGCACAGG + Intergenic
1051087254 9:13364020-13364042 GTTGTATCTCTCACAAGGCCTGG + Intergenic
1051124757 9:13791641-13791663 GTGGTTCATCTCACTGGGACTGG + Intergenic
1051435794 9:17030039-17030061 GTTGTTTACCTTAAAATGACAGG + Intergenic
1052147002 9:25061672-25061694 CTGGTTTATCTCACTGGGACTGG - Intergenic
1056710520 9:88989373-88989395 GCTGTTTCTCTCAAAAGGAGTGG + Intergenic
1057933537 9:99217101-99217123 GTTTTTTATCTTCCAAGGCCTGG - Intronic
1059242490 9:112819191-112819213 GGTGTTTATTTCATAATGACTGG - Intronic
1061212499 9:129201956-129201978 GATGTTAAACTCCCAAGGACAGG - Intergenic
1186149770 X:6661875-6661897 CTTTTCCATCTCACAAGGACAGG - Intergenic
1186955280 X:14674968-14674990 GTTTATTATCTAACAAGGGCAGG - Intronic
1188100149 X:26072760-26072782 GTTGTTTATCCAAGGAGGACTGG + Intergenic
1193419967 X:81271266-81271288 CTGGTTCATCTCACAGGGACTGG - Intronic
1195592694 X:106649610-106649632 TTTGTTTATCTCACAGGAAGTGG + Intronic
1197815801 X:130496951-130496973 TTAGTTTATCACATAAGGACTGG - Intergenic
1200425160 Y:3012451-3012473 GTTTTTTATCTGACAAGAAAAGG - Intergenic
1201394850 Y:13537153-13537175 TTGGTTCATCTCACTAGGACTGG - Intergenic
1201412221 Y:13711322-13711344 GTTGTTTATCTTAAAAGAAAAGG - Intergenic