ID: 957402265

View in Genome Browser
Species Human (GRCh38)
Location 3:79731544-79731566
Sequence AAAACATCCTAGATGCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957402262_957402265 -6 Left 957402262 3:79731527-79731549 CCAATGCTGTCTATCCCAAAACA 0: 1
1: 0
2: 1
3: 17
4: 178
Right 957402265 3:79731544-79731566 AAAACATCCTAGATGCTGTAAGG 0: 1
1: 0
2: 1
3: 14
4: 152
957402261_957402265 -5 Left 957402261 3:79731526-79731548 CCCAATGCTGTCTATCCCAAAAC 0: 1
1: 0
2: 1
3: 23
4: 291
Right 957402265 3:79731544-79731566 AAAACATCCTAGATGCTGTAAGG 0: 1
1: 0
2: 1
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957402265 Original CRISPR AAAACATCCTAGATGCTGTA AGG Intronic
900822978 1:4903718-4903740 AAAATTTCCTAGATGATATAGGG + Intergenic
901939588 1:12651809-12651831 AAATCCTCCTAGCTGCTGGATGG - Intronic
902306703 1:15545805-15545827 AAATCATTCTAGATGCAGTATGG + Intronic
902520974 1:17016267-17016289 AAGAATTCCAAGATGCTGTAGGG + Intergenic
906340560 1:44976557-44976579 AAAATATTCTATAGGCTGTAAGG - Intronic
907172776 1:52485660-52485682 AAAAAATCCTAGATGCTGAAAGG - Intronic
907481244 1:54746870-54746892 ACAATATACTAGATCCTGTAAGG + Intergenic
910337503 1:86151703-86151725 AAAAGATCCAAGTTGCTTTAGGG + Intronic
918158319 1:181872545-181872567 GAAACATACTTGATGCTGTTGGG + Intergenic
918214509 1:182381746-182381768 ACACCATCCAAGAGGCTGTAAGG + Exonic
919196007 1:194287110-194287132 AAAACATCCTTAAAGTTGTAAGG - Intergenic
920049988 1:203158203-203158225 AAAACATTCAAGGTGCTATATGG - Intronic
921147536 1:212372999-212373021 AAAAAATCCTAAATTTTGTATGG + Intronic
1063216368 10:3929633-3929655 ATATCATCCTAGGTGCTGTAAGG + Intergenic
1064904387 10:20330093-20330115 AAAGCATCCAGGATGCTGTGTGG + Intergenic
1065231940 10:23607320-23607342 AAAAAATACAAGAAGCTGTATGG + Intergenic
1065989390 10:30992963-30992985 AAAACATTCAAGATACTGTGTGG + Intronic
1066277808 10:33886176-33886198 AAGACTTCCTAGATACAGTAAGG + Intergenic
1069053853 10:63823341-63823363 AAAAAATCCTAAAATCTGTATGG + Intergenic
1069202833 10:65643955-65643977 AAAAAAGCCTAAATACTGTATGG - Intergenic
1071849061 10:89550205-89550227 AAAACATTCTTGATGTTTTATGG - Intronic
1073781543 10:106844072-106844094 AAAACATCCTAATAGTTGTAAGG + Intronic
1077719909 11:4617736-4617758 AAAAACTACTTGATGCTGTATGG + Intergenic
1079873573 11:25830116-25830138 AAAACATTCAAGGTGCTGCATGG - Intergenic
1081255296 11:40885664-40885686 AAAATATCAAAAATGCTGTAAGG + Intronic
1084095811 11:66910519-66910541 AAAAGATACTAGGTGCTATAGGG + Intronic
1085860720 11:80231599-80231621 AAAACATCCTAAAATTTGTATGG + Intergenic
1089525300 11:119093240-119093262 AAAACATCCTGGATGTTGCACGG + Exonic
1089546675 11:119232147-119232169 AAAACATGCTAGATGAAATATGG - Intronic
1089887047 11:121836898-121836920 AAAAAATCCTAAATTTTGTAAGG + Intergenic
1089956044 11:122572237-122572259 AAAACATTTTAGATGCTTTTAGG + Intergenic
1090384919 11:126352249-126352271 AAATCATCTGAGATGCTGGATGG + Intergenic
1092661041 12:10738794-10738816 ACAATATGCTAGATGCTGCATGG - Intergenic
1093763634 12:22938167-22938189 AAACCATTCAAGATGCTGGATGG + Intergenic
1094253021 12:28388036-28388058 AAAAAATAATAGATGCTGGAAGG - Intronic
1096096998 12:48942017-48942039 AAACCACCCTAGATGCTATATGG - Intronic
1097588012 12:61538181-61538203 AAATCATTCTAGCTGCTGGATGG - Intergenic
1099063545 12:77944310-77944332 AGATCACCCTAGATGCTTTATGG + Intronic
1099605520 12:84797374-84797396 CATACATGCAAGATGCTGTATGG + Intergenic
1101274932 12:103189272-103189294 AAAACAAGCCAGATGCTTTAAGG + Intergenic
1108113963 13:47107926-47107948 AGCACCTCTTAGATGCTGTATGG - Intergenic
1115616811 14:35103084-35103106 AGATCATTCTGGATGCTGTATGG - Intronic
1116375774 14:44198521-44198543 AAAACTTCCTCGATGCTATTTGG + Intergenic
1118927602 14:70206970-70206992 AAAACCACCTAGATGCTGAAAGG + Intergenic
1119800030 14:77435772-77435794 GAAATCTCCTAGATGCTGAACGG + Intronic
1120626667 14:86835880-86835902 AAAAAATAATAGATGCTGTCAGG + Intergenic
1121159543 14:91724861-91724883 AAAACACCCAGGATGCTCTATGG + Intronic
1121736981 14:96225592-96225614 AACATATCCTAGGTGCTGAAGGG - Intronic
1123463569 15:20496382-20496404 AAGACATCCTAGAAGCAGCAAGG + Intergenic
1123654493 15:22504043-22504065 AAGACATCCTAGAAGCAGCAAGG - Intergenic
1124308403 15:28599239-28599261 AAGACATCCTAGAAGCAGCAAGG - Intergenic
1125052968 15:35322621-35322643 AAAACTTGTTAGATGCTGTCAGG - Intronic
1127939867 15:63684050-63684072 AAAACATCTTGGATGCTGGCTGG + Intronic
1129130415 15:73488484-73488506 AAAATACTCTAGGTGCTGTATGG - Intronic
1133655554 16:7860034-7860056 AAGACCTCCTAGAAGCTGTCTGG - Intergenic
1135835724 16:25823477-25823499 AAATCATCCTAAATGATGAAAGG - Intronic
1140318378 16:73922179-73922201 AAAACATGTCAGGTGCTGTATGG - Intergenic
1140616146 16:76666827-76666849 AAAAGAGCATAGAGGCTGTATGG + Intergenic
1142425007 16:89997504-89997526 AAAGCCTCCTGGAAGCTGTAGGG + Intergenic
1145349256 17:22065639-22065661 AAAACAACCTAAATAATGTATGG + Intergenic
1145885858 17:28382061-28382083 AGATCATCCTAGCTGCTGTGTGG + Intronic
1146530065 17:33601019-33601041 AAAGCATTCAAGGTGCTGTATGG + Intronic
1147727783 17:42577498-42577520 AACACATCCTGGGAGCTGTAGGG + Exonic
1149201433 17:54190240-54190262 ACACCAGCCTAGATGCTGTAAGG - Intergenic
1149254674 17:54812147-54812169 AGAAGATCCTCTATGCTGTAAGG - Intergenic
1149707746 17:58710695-58710717 TAAACAACCTAGATGCTTTGAGG + Intronic
1154376289 18:13812529-13812551 AACACAACCTAGAAGCTGGAAGG + Intergenic
1157078891 18:44499619-44499641 AAAATAACCCAGATGCTGTCAGG + Intergenic
1157302445 18:46488825-46488847 GAAACATCCTAAATGCTGTTTGG - Intronic
1157496001 18:48157997-48158019 CAAACATCCTAGATGCCCTGGGG + Intronic
1159294211 18:66461123-66461145 AAAAAATCCTAAAATCTGTATGG - Intergenic
1160175544 18:76591244-76591266 AGTACATTCTCGATGCTGTATGG - Intergenic
1165721843 19:38084593-38084615 AAAAAAACCTAGCTGCTGTGGGG - Intronic
1165876879 19:39014066-39014088 AAAACATCATGGATGCTGACTGG - Intronic
925581907 2:5419249-5419271 AAAAAATCATAGCTGCTGTCAGG - Intergenic
928553168 2:32394631-32394653 AGACCAGCCTGGATGCTGTAAGG + Intronic
929334126 2:40719580-40719602 AAAACATCCTACATGATTAATGG + Intergenic
930759653 2:55020198-55020220 AAAAAATCCTAAAATCTGTATGG + Intronic
933403927 2:81833884-81833906 AAAAAATCCTAAAATCTGTATGG + Intergenic
933570780 2:84009018-84009040 AAAAAATCCTAAAATCTGTATGG + Intergenic
934036231 2:88090942-88090964 ACAACATCCTAGCTGTTGAAAGG - Intronic
934877096 2:97933153-97933175 AAAACATCCTAAGTGGTGTTAGG - Intronic
937946152 2:127339957-127339979 AAAACATGCCATATCCTGTATGG + Intronic
939081156 2:137663362-137663384 AAAATATTCTTTATGCTGTAGGG + Exonic
941207106 2:162587503-162587525 AAAAAATTCTAAATGCTATAAGG - Intronic
942951185 2:181723764-181723786 AAGACAGCCTCTATGCTGTAAGG - Intergenic
943330369 2:186551736-186551758 AAAACATGGTAGAGGCTGTGTGG + Intergenic
945787967 2:214267796-214267818 AAAAAATCCTAGAATTTGTATGG + Intronic
947994004 2:234511849-234511871 CAGACATCCTTGATGCTGTCTGG - Intergenic
1170209139 20:13830338-13830360 AAATCATCCTGTATACTGTATGG + Intergenic
1174863929 20:54117455-54117477 AAAATAACCTAGAGGCAGTAAGG - Intergenic
1178151735 21:29802600-29802622 AGATCATCTTAGAAGCTGTATGG - Intronic
1178428982 21:32502535-32502557 CTAACATCTTAGATGCTCTACGG - Intronic
1178858493 21:36270023-36270045 AGAAAATCCTAGAAGCTGTGGGG + Exonic
954180063 3:48874627-48874649 AAAACAACACAGATGCTGTTAGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
957402265 3:79731544-79731566 AAAACATCCTAGATGCTGTAAGG + Intronic
957937343 3:86961940-86961962 AAAACATTTTATATGCTATAGGG + Intronic
960068130 3:113397520-113397542 ATGACATCCTAGCTGCAGTATGG + Intronic
962789458 3:138797971-138797993 AAAAAATCCTATATACTCTATGG + Intronic
963929105 3:150983421-150983443 GAAAAATCCTAGATGCAGAAGGG - Intergenic
964466238 3:156996547-156996569 AAATCATTCTGGATGCTGGACGG + Intronic
971380974 4:26097367-26097389 AGACCATCCTGGATGCTGTGGGG + Intergenic
974166382 4:58209815-58209837 AAAAAAACCCAGAGGCTGTAAGG + Intergenic
974580577 4:63795382-63795404 AGAAGGTCCTAGATGATGTAGGG - Intergenic
975885973 4:78965205-78965227 AAACCATCCTTGTTGCTTTATGG + Intergenic
975909900 4:79255064-79255086 ACAAAATACTACATGCTGTATGG + Intronic
976542064 4:86289394-86289416 AGACCATTCTAGATGCTGTATGG + Intronic
982483059 4:155934777-155934799 ATTACTTCCTAGATGCAGTAGGG - Intronic
982513207 4:156310536-156310558 AAAACATCCTAAAATGTGTATGG + Intergenic
983027797 4:162758690-162758712 AAAACATACTGGATGCAGAAAGG - Intergenic
983110691 4:163745779-163745801 AAAACAACCCAGCTTCTGTAAGG - Intronic
984124483 4:175789973-175789995 ATAACATCCTTAATACTGTAAGG + Intronic
986736552 5:10672625-10672647 AACACATCCGAGATGCTTTAAGG + Intergenic
990489558 5:56290886-56290908 AAAGCATGCAAGATTCTGTATGG + Intergenic
990493742 5:56326398-56326420 AAAACCTCCCAGAGGCTGAATGG + Intergenic
993514312 5:88811585-88811607 AAAACATAGGAGATTCTGTAGGG - Intronic
994111009 5:96004107-96004129 AAAACATTCTGGATGTTGGATGG + Intergenic
997966425 5:138360428-138360450 AAAACAGACCTGATGCTGTAAGG - Intronic
999062434 5:148650837-148650859 AAAACAGGCTAGATACTATAAGG - Intronic
999417826 5:151415208-151415230 AGATCAGTCTAGATGCTGTATGG - Intergenic
999824405 5:155260131-155260153 AAAACATTCTATATGGTGTTGGG + Intergenic
1002967883 6:1985281-1985303 AGAGCATCCTAGAGGCTGAATGG + Intronic
1005387223 6:25297296-25297318 AAGACATCCAAGATGCTTGAAGG - Intronic
1007573296 6:42908754-42908776 AAAACACCCTGCATCCTGTAGGG - Intergenic
1009159521 6:60264403-60264425 AAAATGTCCAAGATGCTGCATGG + Intergenic
1009669189 6:66724128-66724150 TAATCAACCTAGAAGCTGTATGG + Intergenic
1010367204 6:75065198-75065220 AAACCATCTCAGGTGCTGTAGGG - Intergenic
1012773750 6:103478126-103478148 ATAACATTCTAGAGGCTCTAGGG + Intergenic
1013161477 6:107549454-107549476 AAAAAACCCTAGATGCCTTATGG + Intronic
1016233531 6:141833859-141833881 AAAACAACCTAGATATTGAATGG - Intergenic
1017875406 6:158520106-158520128 AAATCAGCCTAGTTGCTGAATGG - Intergenic
1018720640 6:166569400-166569422 CAAACATCTGAGATGCTGCAAGG - Intronic
1018850452 6:167586295-167586317 AAAACATCCTAAAATGTGTATGG + Intergenic
1021985496 7:26094319-26094341 AAAACAGCCAAGATGCTTTGAGG - Intergenic
1022229175 7:28396981-28397003 AATACATCTTAGATGCCATAAGG + Intronic
1025278468 7:57606410-57606432 AAAACAACCTAAATAATGTATGG - Intergenic
1028480932 7:91303786-91303808 AGAACATAGTAGCTGCTGTAAGG + Intergenic
1031444912 7:121841031-121841053 AAAGCATCCCAAATCCTGTAAGG - Intergenic
1034753326 7:153591309-153591331 AAGACATCCTACATGCTGTGTGG + Intergenic
1035837008 8:2765169-2765191 AACACATCTTAAATGCAGTACGG + Intergenic
1035937040 8:3852521-3852543 AAAACATAGTAGATGGTGTTAGG + Intronic
1037152762 8:15657326-15657348 AAAACATTCTGGATGCAGTATGG - Intronic
1037212464 8:16407934-16407956 AAAATGTACTAGATGCTGCAGGG - Intronic
1037481577 8:19311206-19311228 AACACATCCTAGATCATGGAGGG + Intergenic
1037559918 8:20064192-20064214 AAACCATGCTAGGTGCTGTGGGG + Intergenic
1039855831 8:41413070-41413092 TAAACATCCTAGGTGCAGCATGG - Intergenic
1041136691 8:54766684-54766706 AAAACACCCTATATGTTTTAAGG + Intergenic
1044238929 8:89865949-89865971 AAAACATCATTGATGTTGTAGGG - Intergenic
1045225056 8:100235881-100235903 AAAAATTCCTAGATGGTGTATGG + Intronic
1048402272 8:134083158-134083180 AAAACATACTAGACACTGTATGG - Intergenic
1050549034 9:6733259-6733281 AAAACATCATGGATGCTGGCTGG + Intronic
1052396536 9:27945411-27945433 AATCCATCCTAAATACTGTAGGG + Intergenic
1053513447 9:38709005-38709027 ATAACATCCTAAGTGATGTAAGG - Intergenic
1055336063 9:75234819-75234841 AAAAGTTCCCAGATGCAGTAAGG + Intergenic
1056444277 9:86649707-86649729 AATTCATCCAAGATGTTGTATGG + Intergenic
1057669260 9:97074540-97074562 AAAACATCATGGATGCTGGCTGG + Intergenic
1058014678 9:100017050-100017072 GAAACATACAAGATGCTATATGG + Intronic
1059845304 9:118269100-118269122 GAATCATTCTAGATGCTTTATGG - Intergenic
1059970761 9:119665866-119665888 AAAAGCTCCTAGATTCTGAAAGG + Intergenic
1060431355 9:123553662-123553684 GAAAAATCCTAGAAGCTGGATGG + Intronic
1188376320 X:29433106-29433128 AACAAATCTTAGATACTGTAAGG - Intronic
1188732333 X:33665371-33665393 TAAACATCTTGTATGCTGTAGGG - Intergenic
1190487353 X:50941124-50941146 AAAACGTCATTGATGCTGGATGG + Intergenic
1197548451 X:127857318-127857340 AAAAGATCCTAGATGATGATTGG + Intergenic
1200938069 Y:8755734-8755756 AAACCTTCCTAGACGTTGTAGGG - Intergenic
1202179848 Y:22130398-22130420 AGGACAGCCTAGATGTTGTAGGG - Intergenic
1202211513 Y:22455996-22456018 AGGACAGCCTAGATGTTGTAGGG + Intergenic