ID: 957405271

View in Genome Browser
Species Human (GRCh38)
Location 3:79767351-79767373
Sequence TGCCCCCAAGAAGCCAAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957405267_957405271 5 Left 957405267 3:79767323-79767345 CCGCATCCCTAGAGCAAATTCCG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG 0: 1
1: 0
2: 1
3: 12
4: 177
957405265_957405271 26 Left 957405265 3:79767302-79767324 CCACTACACCGCTGATGCTCGCC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG 0: 1
1: 0
2: 1
3: 12
4: 177
957405264_957405271 27 Left 957405264 3:79767301-79767323 CCCACTACACCGCTGATGCTCGC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG 0: 1
1: 0
2: 1
3: 12
4: 177
957405269_957405271 -2 Left 957405269 3:79767330-79767352 CCTAGAGCAAATTCCGCTGTGTG 0: 1
1: 0
2: 0
3: 3
4: 87
Right 957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG 0: 1
1: 0
2: 1
3: 12
4: 177
957405268_957405271 -1 Left 957405268 3:79767329-79767351 CCCTAGAGCAAATTCCGCTGTGT 0: 1
1: 0
2: 1
3: 3
4: 58
Right 957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG 0: 1
1: 0
2: 1
3: 12
4: 177
957405266_957405271 18 Left 957405266 3:79767310-79767332 CCGCTGATGCTCGCCGCATCCCT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG 0: 1
1: 0
2: 1
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957405271 Original CRISPR TGCCCCCAAGAAGCCAAAAG CGG Intronic
901612167 1:10507601-10507623 TGCCCCCTAGAAGCTACCAGGGG - Intronic
902116827 1:14128153-14128175 TGCCCCCAAGCACACAAAAAGGG - Intergenic
903141114 1:21339781-21339803 TCCCCCCAGGAAGTCCAAAGGGG + Intronic
904342815 1:29848566-29848588 TTCCCCCAAGAAATCAAAATGGG - Intergenic
904512593 1:31025241-31025263 TGACACCAAGAGGCCAACAGTGG + Intronic
904946240 1:34200782-34200804 TGGCACCAAGGAGCCAAAAAAGG + Exonic
905246440 1:36617791-36617813 TGCCCCCCACAAGCTAAATGAGG - Intergenic
909501566 1:76340422-76340444 TGCTCCCAAGGTGCCAAAGGGGG + Intronic
914383421 1:147142178-147142200 TGTCCCCAAGAACACAAAATGGG - Intergenic
917600154 1:176565891-176565913 TACCTTCAAGAAGCCAGAAGAGG - Intronic
917916512 1:179707748-179707770 TGCTTCCTAGAAGCCAACAGAGG - Intergenic
919065822 1:192691879-192691901 TGCCCCCAGGAAGTAAAAACTGG - Intergenic
924714696 1:246562495-246562517 TGTCAACATGAAGCCAAAAGTGG + Intronic
1065378973 10:25069764-25069786 TGCCCTCAAGGAGCTAACAGTGG - Intergenic
1070987322 10:80700028-80700050 AGCCCCCTAGTAGCCAAAAAAGG + Intergenic
1072424815 10:95320926-95320948 TGCCCCAGAGAGGCCAAGAGTGG - Intronic
1074018411 10:109559414-109559436 TGCCCCCAAGAATGCAGAACTGG - Intergenic
1075337290 10:121617609-121617631 TGCCCCCAACACCCCAAAAGAGG + Intergenic
1075425372 10:122337943-122337965 TGCCCCCCAGAAGGGGAAAGAGG - Intronic
1076314746 10:129532404-129532426 TGACCACAAGAAGCCAAACTTGG - Intronic
1077460695 11:2707913-2707935 GGCGCTCAAGAAGCCAAATGTGG - Intronic
1078444946 11:11397064-11397086 TACCCCGAAAAAGGCAAAAGGGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1078908555 11:15710099-15710121 TGCCCTCCAGAAGACAATAGGGG + Intergenic
1080613119 11:33922349-33922371 TGCCCCAAAGAAGTTAAAACAGG + Intergenic
1081804800 11:45884775-45884797 TGATCCCAAGAAGTCAACAGTGG + Intergenic
1083715853 11:64576546-64576568 TGCCCCTGAGCAGCCAAATGTGG - Intergenic
1083835225 11:65262223-65262245 TGCGCCCAAGAAGCCCACGGGGG - Exonic
1084088336 11:66864910-66864932 TGCCCCCGAGAAGCGGAAATGGG - Intronic
1084942470 11:72620332-72620354 GGCCCCTCAGAAGCCACAAGGGG + Intronic
1090508542 11:127346209-127346231 TGCCCCCAGGAAGAGAAAAATGG - Intergenic
1097187555 12:57203870-57203892 TGCCCCCAGGAAGGGAAAATAGG - Intronic
1098481460 12:70966804-70966826 TGTCCCCAAAATGCCAAATGCGG + Intergenic
1098524321 12:71469566-71469588 TGACACAAAGAAGCCAAGAGGGG + Intronic
1099531103 12:83782385-83782407 TGCCCACAAGATGCCACAAGTGG - Intergenic
1100616769 12:96236919-96236941 AGCCCACAAGAAGCCAGAAGAGG - Intronic
1102574539 12:113847850-113847872 TGTCGCAAAGAAGCCAAAAGAGG - Intronic
1103967258 12:124647686-124647708 TGTCCCCCAGAAGCCAGAAAAGG - Intergenic
1104388288 12:128370116-128370138 GGCCCCCAGGAAGTCAACAGTGG - Intronic
1106363257 13:29051657-29051679 TGCCTCAAAGAAGCAAAAAATGG + Intronic
1106667545 13:31868063-31868085 TGGCCTCAGGCAGCCAAAAGAGG - Intergenic
1108592640 13:51924539-51924561 TGGCCCCAAGAATGCAGAAGTGG - Intergenic
1109651550 13:65333847-65333869 TGCCAGTAAGAAGTCAAAAGGGG + Intergenic
1109875192 13:68393553-68393575 TGCCACAAAGAATCAAAAAGTGG - Intergenic
1113819542 13:113203587-113203609 TGGCCCCAAGAAGACAACACTGG + Intronic
1115658366 14:35465779-35465801 TGCTGCCAAGAAGCCAAAACTGG - Intergenic
1117680518 14:58198941-58198963 TGAGCCCAAGAAGTCTAAAGCGG - Intronic
1119046462 14:71321629-71321651 TGTCCCCAAGACCCCCAAAGGGG - Intronic
1119160850 14:72451434-72451456 TGAGCACAGGAAGCCAAAAGCGG + Intronic
1119634483 14:76262886-76262908 TACCCCCAAGAAGGCATCAGTGG + Intergenic
1122065009 14:99166773-99166795 TGCCCCAAAGAAGTCAAAAGAGG - Intergenic
1122330732 14:100910713-100910735 TGATTCCAAGAAACCAAAAGAGG - Intergenic
1122985886 14:105211446-105211468 AGCCCCCAGGAGGCCAGAAGGGG - Intronic
1124789558 15:32715293-32715315 TAACCCCAAGAAGCTAAAAGAGG - Intergenic
1127397991 15:58558397-58558419 TGCCCTCAAGACAGCAAAAGAGG - Intronic
1128582480 15:68819254-68819276 TCCCCCCAAGGGGCCAAGAGGGG + Intronic
1129650396 15:77483112-77483134 TCACCCCAGGAAGCCAAATGAGG + Exonic
1129745180 15:78014006-78014028 TGCCCCGAAGATGGGAAAAGGGG + Intronic
1130747835 15:86675135-86675157 GGAGTCCAAGAAGCCAAAAGCGG + Intronic
1131319186 15:91369720-91369742 TGCTCCCACGAAGCCAACACAGG + Intergenic
1136021013 16:27439998-27440020 TGCCCCGGGGAAGACAAAAGAGG + Intronic
1136032439 16:27513586-27513608 TGCCTCCTAGAAACCAAAAAAGG + Intronic
1137734379 16:50713086-50713108 TGCCCCCAAGATGTGGAAAGAGG - Intronic
1138599676 16:58047090-58047112 TGCCCTCAAGAGTCCAGAAGAGG + Intergenic
1138629033 16:58278816-58278838 TGCCCCTAACAATGCAAAAGGGG - Intronic
1142287897 16:89178898-89178920 TGACCCCAAGAAGCCAGTGGCGG - Intronic
1142722300 17:1784735-1784757 TGGCCCCAAAAAGCGACAAGAGG - Intronic
1143130580 17:4674594-4674616 CGCCCCCAAGAAGCTAAAGCTGG - Exonic
1145043707 17:19595745-19595767 TGCCCCCAAGAAGCATAACCTGG - Intergenic
1145780640 17:27560694-27560716 TGCACCCCAGGAGCCAAATGCGG - Intronic
1148053416 17:44780073-44780095 TGCCCCCAGGCAGCCACCAGTGG + Exonic
1149481251 17:57005168-57005190 TGCCACCATGAGGCCACAAGTGG - Intronic
1149785125 17:59428208-59428230 TGCTCCCAAGAAGAAAAGAGAGG - Intergenic
1150481773 17:65516655-65516677 TGCCCCTAAGGAGGCAGAAGCGG + Intergenic
1151218918 17:72597095-72597117 TGCCCCCAAAAAGCAGATAGAGG - Intergenic
1151250581 17:72830843-72830865 TGCCCCCATGGAGCCGACAGGGG - Intronic
1152484975 17:80584637-80584659 AGCCCCAAAGAAGTCAAAAGGGG - Intronic
1154374614 18:13798817-13798839 TGCCCCGCAGAAGCCAAGGGAGG - Intergenic
1155122750 18:22839853-22839875 TACCCCCAAAATGCCAAATGAGG + Intronic
1159118623 18:64144080-64144102 TGGCCTCAAGAAGCCAAACAGGG - Intergenic
1160264606 18:77329493-77329515 TGCCACCAAGAAGACACAATGGG + Intergenic
1162855981 19:13469019-13469041 TGCCCCCAAGAAGTCAGGTGAGG + Intronic
1163003324 19:14382332-14382354 TGCCCCCAAGAAACCCAAGGTGG - Intronic
1163716268 19:18874165-18874187 TGTCCCCAAGAAAGCAGAAGTGG - Intronic
1165425791 19:35744824-35744846 TGCCCCTAAGAAACCAGAAAAGG + Intronic
1166396570 19:42445582-42445604 TGACCCCAGGAAACCAAGAGTGG + Intergenic
1166688411 19:44809289-44809311 TGACCCCAGGAAGCAAAATGTGG + Intronic
1166696399 19:44854089-44854111 GCCCCACAAGAAGCTAAAAGTGG + Intronic
1167064717 19:47176194-47176216 TGCTGCCAAGAAAGCAAAAGAGG - Intronic
1167704195 19:51068924-51068946 TGCCCTCCAGAAGGCAAGAGAGG - Intergenic
925358349 2:3259397-3259419 TGCCCTCAATAAAGCAAAAGTGG + Intronic
926207249 2:10842559-10842581 TGCTATCAAGAAGCCAAAGGAGG - Intergenic
927289940 2:21395423-21395445 TGCCCCGGAGAATCCTAAAGGGG + Intergenic
927981349 2:27377020-27377042 TGGCTCCAAGAGGCCAGAAGCGG - Exonic
934713759 2:96531572-96531594 TGCCCCCAGGATGCGGAAAGTGG + Intergenic
936237062 2:110751461-110751483 TGCACCCAAAAACCCAAAAATGG - Intronic
937757095 2:125552981-125553003 TGATCCCAAGAAGCCATCAGAGG + Intergenic
938072933 2:128317918-128317940 GGCCCCCAAGAGGGCAGAAGGGG + Intronic
939277819 2:140023482-140023504 TGGCCCCAAGAATGCAAAACAGG - Intergenic
948456088 2:238105256-238105278 TTCCCCAAAGAGGCCAGAAGTGG - Intronic
948613261 2:239182892-239182914 TGCCCTCCAGAAGCCAACTGAGG - Intronic
1172104434 20:32508127-32508149 TGACCACAAAATGCCAAAAGAGG - Intronic
1172241545 20:33416162-33416184 TGCCCCCATGAGGCAAAAACTGG - Intronic
1172857306 20:38015327-38015349 TGGCCCCAAGAAGCCAGAGAAGG + Intronic
1173026132 20:39309248-39309270 AGCTCCCAAGAGTCCAAAAGTGG - Intergenic
1173561696 20:44010725-44010747 TCCCCCCAAGAAGCAAACCGAGG + Intronic
1173606930 20:44338072-44338094 AGCCCCCAAGAAGTCAAAGGAGG + Intronic
1173663136 20:44747676-44747698 TGCCCCCAAGTGGCCAGAAAAGG - Intronic
1174039401 20:47688330-47688352 TGCCCCTAAGAAGGCAAAGGGGG + Intronic
1177050971 21:16233348-16233370 TTCTCTCAAAAAGCCAAAAGTGG + Intergenic
1177543006 21:22520291-22520313 TGCACCCAAGAAGCAGAGAGGGG - Intergenic
1183531530 22:38356688-38356710 TGCCAACATGATGCCAAAAGTGG - Intronic
1183703012 22:39460353-39460375 TGCCCCCAAGCAGCCAGCACAGG - Intronic
949181078 3:1132253-1132275 TGCAACCAATAAGCCAAAAATGG + Intronic
949260068 3:2095846-2095868 TGTCTCCAAAAAGTCAAAAGCGG + Intergenic
949503290 3:4702810-4702832 AGTCTGCAAGAAGCCAAAAGAGG - Exonic
949879686 3:8651676-8651698 GTCTCCCATGAAGCCAAAAGTGG + Intronic
949989045 3:9562245-9562267 TGACCCCAAGAGGGCAAGAGGGG - Intergenic
951525166 3:23646485-23646507 TGCCCTAAAGCAGCCAACAGTGG - Intergenic
953349465 3:42203896-42203918 TGCTCCCAAGAAGCAAAAACAGG - Intronic
954196402 3:48999588-48999610 TGCACCCAGGGAGCCAACAGAGG + Intronic
954747385 3:52794878-52794900 TCACCCCAAGCAGCCGAAAGGGG - Exonic
954808166 3:53232211-53232233 AGCCCCCAAGAAGCTGCAAGTGG + Intronic
957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG + Intronic
959754360 3:109879473-109879495 TGACTCTAAGAAGCCAAATGTGG + Intergenic
960178396 3:114545059-114545081 TGCCCCCAGGAAGAAAGAAGAGG - Intronic
960576699 3:119237199-119237221 TGTCCCTAAGAAACCAACAGTGG + Intronic
960589725 3:119353860-119353882 TGCCTTCAAGAAGCCAAGAAGGG - Intronic
963826333 3:149958314-149958336 TGCCCTCCAGAAGCCAGAAAAGG - Intronic
967442855 3:189528911-189528933 GGCCCCAAAGAAGACAGAAGTGG - Intergenic
967885501 3:194330920-194330942 TGGCCCAAAGAAGACATAAGAGG + Intergenic
971168008 4:24204203-24204225 GGCCTACAAGGAGCCAAAAGGGG + Intergenic
971501595 4:27324395-27324417 TGCCCACAAAGAGCCAAAAGGGG + Intergenic
973056740 4:45668860-45668882 TGGCCTCTAGAAGCCAAAAAGGG - Intergenic
973184670 4:47311561-47311583 TGCCCCCTAGAAGCTGAAAAAGG + Intronic
973864204 4:55095414-55095436 TGGCCCCCAGAAGGTAAAAGAGG + Intronic
978380001 4:108116948-108116970 AGCCCACAAGATGCCAAAGGTGG + Intronic
986339981 5:6780551-6780573 TGCCCTCTAGTAGCCCAAAGGGG - Intergenic
988220666 5:28342961-28342983 GGCTCCCAAGAAGCAAAAAAAGG + Intergenic
994932966 5:106213222-106213244 TGCTTCAAAGAAGCTAAAAGGGG + Intergenic
997676538 5:135717241-135717263 TGACCGCAAGAAGCAGAAAGAGG - Intergenic
998154589 5:139777331-139777353 AGGCCCCAAGGAGCTAAAAGAGG - Intergenic
999119130 5:149195501-149195523 TGCCCCCAAGGAGCTGAAGGAGG - Intronic
1000719790 5:164692586-164692608 TGCCCTCTAGAAGCTGAAAGTGG + Intergenic
1003790430 6:9540695-9540717 TGCCCTCTAGAGGGCAAAAGGGG - Intergenic
1005894958 6:30170194-30170216 TGCCCTCTAGAGACCAAAAGGGG + Intronic
1007731857 6:43952195-43952217 TGCCACCCAGAAGCCAGCAGAGG + Intergenic
1007740480 6:44006568-44006590 TGACCCCAGGAAGCCCAAGGCGG + Intergenic
1008911534 6:56739050-56739072 TGCCCCTAAGGGGCCAATAGAGG - Intronic
1010034921 6:71313857-71313879 TGCCCCCAAGAAGCCATCTTGGG - Intergenic
1010445559 6:75945052-75945074 TTCTTCCAAGAAGCCAAAGGTGG - Intronic
1013304010 6:108831527-108831549 TGCCACCAAGAAGGCTGAAGGGG - Intergenic
1014270539 6:119330946-119330968 TGCCCACATGGAGCCCAAAGGGG - Intronic
1014624009 6:123703846-123703868 TGCCCACATGATGCCAGAAGTGG + Intergenic
1017734023 6:157344216-157344238 TGACTCCAAGAAGCCCAGAGTGG - Intergenic
1018025284 6:159800649-159800671 TGCGCTCAAGAAGCCAAGTGAGG - Intronic
1022773069 7:33495226-33495248 TGCTCCCAAAAAGGCAAAAAGGG - Intronic
1024215262 7:47243213-47243235 TGGCCCCAATAAGACAAAGGAGG - Intergenic
1028110360 7:86933572-86933594 TGGCCCAAAGAAGCCATAAAAGG + Intronic
1036043570 8:5113922-5113944 TGACCCCAAGATGAGAAAAGAGG + Intergenic
1037766873 8:21777651-21777673 AGCCCCCATGCAGCCAAGAGTGG + Intronic
1038541713 8:28395449-28395471 TGGACCCAAGAAACTAAAAGAGG - Intronic
1038899178 8:31822893-31822915 GGTACCCAAGAAGCCAACAGAGG + Intronic
1039435461 8:37556606-37556628 TGGGCCCAGCAAGCCAAAAGGGG + Intergenic
1040307239 8:46218444-46218466 AGGCCCCAAAAAGCCAAAACGGG - Intergenic
1040330969 8:46385608-46385630 TGCCCCCCACAAGCAAAAACGGG + Intergenic
1040520079 8:48169132-48169154 AGCCACCAAGAAGTCCAAAGTGG - Intergenic
1041247292 8:55900998-55901020 TGCCACCAAGAAACCAGAACAGG - Intronic
1044355352 8:91216231-91216253 TTCCCCCAAGAAGGGGAAAGAGG + Intronic
1045478525 8:102574398-102574420 TGGCCTCATGGAGCCAAAAGAGG + Intergenic
1046552921 8:115739124-115739146 TGGCTCAAAGAAGACAAAAGAGG + Intronic
1047214367 8:122864653-122864675 GGCCCCAGAGAAGGCAAAAGCGG + Intronic
1047303865 8:123637554-123637576 TGCCCCCAAGAAGCCATTCTTGG - Intergenic
1049912531 9:283313-283335 TGCCTCCATGACGCCACAAGTGG + Intronic
1053353610 9:37429313-37429335 TGCCACCAAAAAGTCAAATGGGG + Intronic
1056152108 9:83801248-83801270 TGCCACCCAGAAGCTAGAAGAGG + Intronic
1057828216 9:98387298-98387320 TTCCCCCAGGAGGCCAAGAGGGG + Intronic
1058592283 9:106577746-106577768 TTCCCCCAAGAAACTAAGAGAGG - Intergenic
1061035143 9:128109345-128109367 CGCCTCTAAGAAGCCGAAAGGGG - Intergenic
1062424030 9:136497878-136497900 TGCCCCCAATAAGGCACAAAAGG + Intronic
1186987657 X:15034171-15034193 AACCCCAAAGAAGGCAAAAGTGG - Intergenic
1189346357 X:40244461-40244483 TGCCCCAAACTAGCCAAAACAGG - Intergenic
1189737569 X:44087291-44087313 AGTCCCCAAGAGGCTAAAAGAGG + Intergenic
1192163661 X:68808892-68808914 TGCCCCAAAGAATCCCAGAGAGG - Intergenic
1193907366 X:87260138-87260160 AGACCCCAAGAAGCTAAAGGAGG - Intergenic
1195721033 X:107868469-107868491 GGACCCCAAGAAGCTAGAAGAGG + Intronic
1196282661 X:113840923-113840945 AGCCCATAAGAAGCCAAAACAGG - Intergenic
1196911575 X:120489243-120489265 ACCCCCCCAGAAGCGAAAAGAGG + Intergenic
1199056226 X:143298345-143298367 TGCCCTCCAGAAGCTAATAGAGG + Intergenic
1199167582 X:144695546-144695568 TGCCGCCAAGAAAGCAAAATAGG + Intergenic
1199799777 X:151238621-151238643 TGTGCCAAATAAGCCAAAAGTGG - Intergenic