ID: 957405724

View in Genome Browser
Species Human (GRCh38)
Location 3:79773879-79773901
Sequence GTCTCGAGGAACCACGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957405717_957405724 23 Left 957405717 3:79773833-79773855 CCCATTCTTTGTTTTGTGTTGTG No data
Right 957405724 3:79773879-79773901 GTCTCGAGGAACCACGGGTCAGG No data
957405718_957405724 22 Left 957405718 3:79773834-79773856 CCATTCTTTGTTTTGTGTTGTGT No data
Right 957405724 3:79773879-79773901 GTCTCGAGGAACCACGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957405724 Original CRISPR GTCTCGAGGAACCACGGGTC AGG Intergenic
No off target data available for this crispr