ID: 957408654

View in Genome Browser
Species Human (GRCh38)
Location 3:79807378-79807400
Sequence CTGAGCTAGGACTCAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957408651_957408654 -5 Left 957408651 3:79807360-79807382 CCTACAGCTAATATGTTTCTGAG No data
Right 957408654 3:79807378-79807400 CTGAGCTAGGACTCAAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957408654 Original CRISPR CTGAGCTAGGACTCAAAAGT GGG Intergenic
No off target data available for this crispr