ID: 957415356

View in Genome Browser
Species Human (GRCh38)
Location 3:79895207-79895229
Sequence CTGCCTTTGGGCTGCTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957415351_957415356 24 Left 957415351 3:79895160-79895182 CCTTCATTTGCATGTAATTAAAA No data
Right 957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957415356 Original CRISPR CTGCCTTTGGGCTGCTACTC TGG Intergenic
No off target data available for this crispr