ID: 957415568

View in Genome Browser
Species Human (GRCh38)
Location 3:79898635-79898657
Sequence TTCTTAACATGAGTCTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957415568_957415572 2 Left 957415568 3:79898635-79898657 CCTTAAAAGACTCATGTTAAGAA No data
Right 957415572 3:79898660-79898682 ATGCAGGGAAGTTTGAAGATTGG No data
957415568_957415574 8 Left 957415568 3:79898635-79898657 CCTTAAAAGACTCATGTTAAGAA No data
Right 957415574 3:79898666-79898688 GGAAGTTTGAAGATTGGAGTGGG No data
957415568_957415573 7 Left 957415568 3:79898635-79898657 CCTTAAAAGACTCATGTTAAGAA No data
Right 957415573 3:79898665-79898687 GGGAAGTTTGAAGATTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957415568 Original CRISPR TTCTTAACATGAGTCTTTTA AGG (reversed) Intergenic