ID: 957416133

View in Genome Browser
Species Human (GRCh38)
Location 3:79908057-79908079
Sequence CCTAGTCAAGGCCAAAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957416133_957416136 22 Left 957416133 3:79908057-79908079 CCTTAATTTTGGCCTTGACTAGG No data
Right 957416136 3:79908102-79908124 GCAAATTCCACTTCCAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957416133 Original CRISPR CCTAGTCAAGGCCAAAATTA AGG (reversed) Intergenic
No off target data available for this crispr