ID: 957416135

View in Genome Browser
Species Human (GRCh38)
Location 3:79908069-79908091
Sequence AGCAATGAATATCCTAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957416135_957416136 10 Left 957416135 3:79908069-79908091 CCTTGACTAGGATATTCATTGCT No data
Right 957416136 3:79908102-79908124 GCAAATTCCACTTCCAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957416135 Original CRISPR AGCAATGAATATCCTAGTCA AGG (reversed) Intergenic
No off target data available for this crispr