ID: 957416250

View in Genome Browser
Species Human (GRCh38)
Location 3:79909297-79909319
Sequence AAAAAGACACAGATGTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957416246_957416250 12 Left 957416246 3:79909262-79909284 CCAGAGGAGGCAGCAGCTACTAG No data
Right 957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG No data
957416245_957416250 21 Left 957416245 3:79909253-79909275 CCAGAAGAGCCAGAGGAGGCAGC No data
Right 957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG No data
957416243_957416250 27 Left 957416243 3:79909247-79909269 CCTGAGCCAGAAGAGCCAGAGGA No data
Right 957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957416250 Original CRISPR AAAAAGACACAGATGTAGCT AGG Intergenic
No off target data available for this crispr